Accesso libero

Morphological Characterization and Assessment of Genetic Variability of Tylenchulus semipenetrans Populations from Southern Iran

Mohammad Rumiani

Mohammad Rumiani

Department of Plant Protection, School of Agriculture, Shiraz UniversityShiraz, Iran
Cerca questo autore su
Sciendo|Google Scholar
Rumiani, Mohammad
, 
Miloslav Zouhar

Miloslav Zouhar

Department of Plant Protection, Faculty of Agrobiology, Food and Natural Resources, Czech University of Life SciencesPrague, Czech Republic
Cerca questo autore su
Sciendo|Google Scholar
Zouhar, Miloslav
, 
Akbar Karegar

Akbar Karegar

Department of Plant Protection, School of Agriculture, Shiraz UniversityShiraz, Iran
Cerca questo autore su
Sciendo|Google Scholar
Karegar, Akbar
, 
Habiballah Hamzehzarghani

Habiballah Hamzehzarghani

Department of Plant Protection, School of Agriculture, Shiraz UniversityShiraz, Iran
Cerca questo autore su
Sciendo|Google Scholar
Hamzehzarghani, Habiballah
, 
Ahmad Tahmasebi

Ahmad Tahmasebi

Institute of Biotechnology, School of Agriculture, Shiraz UniversityShiraz, Iran
Cerca questo autore su
Sciendo|Google Scholar
Tahmasebi, Ahmad
 e 
Milad Rashidifard

Milad Rashidifard

Department of Zoology and Entomology, University of the Free StateBloemfontein, South Africa
Cerca questo autore su
Sciendo|Google Scholar
Rashidifard, Milad
  
15 dic 2024
Morphological Characterization and Assessment of Genetic Variability of Tylenchulus semipenetrans Populations from Southern Iran's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Categoria dell'articolo: Research Paper
Pubblicato online: 15 dic 2024
Ricevuto: 29 lug 2024
DOI: https://doi.org/10.2478/jofnem-2024-0047
Parole chiave
© 2024 Mohammad Rumiani et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1:

Geographical location of the sampled areas. The majority of the samples were collected in the citrus-growing regions (known as the citrus belt) of Fars province, southern Iran (shown in green: Kazerun, Shiraz, Ghir, Jahorm, Fasa and Darab). Two samples were also collected from Mazandaran province in northern Iran (shown with red border).
Geographical location of the sampled areas. The majority of the samples were collected in the citrus-growing regions (known as the citrus belt) of Fars province, southern Iran (shown in green: Kazerun, Shiraz, Ghir, Jahorm, Fasa and Darab). Two samples were also collected from Mazandaran province in northern Iran (shown with red border).

Figure 2:

Principal Component Analysis (PCA) performed on populations of Tylenchulus semipenetrans collected from citrus orchards in Fars province, focusing on the morphometric characteristics of the second-stage juveniles (A) and males (B).
Principal Component Analysis (PCA) performed on populations of Tylenchulus semipenetrans collected from citrus orchards in Fars province, focusing on the morphometric characteristics of the second-stage juveniles (A) and males (B).

Figure 3:

Bayesian phylogenetic tree of Tylenchulus semipenetrans isolates from citrus orchards in Fars province based on the ITS of rDNA sequences, analyzed under the General Time Reversible with a gamma distribution (GTR + G) model. Numbers at nodes are posterior probability values. Sequences with codes in the parentheses generated in this study. The codes in parentheses indicate the haplotype of the relevant population.
Bayesian phylogenetic tree of Tylenchulus semipenetrans isolates from citrus orchards in Fars province based on the ITS of rDNA sequences, analyzed under the General Time Reversible with a gamma distribution (GTR + G) model. Numbers at nodes are posterior probability values. Sequences with codes in the parentheses generated in this study. The codes in parentheses indicate the haplotype of the relevant population.

Figure 4:

Bayesian phylogenetic tree of Tylenchulus semipenetrans isolates from citrus orchards in Fars province based on D2-D3 28S rDNA partial sequences, analyzed by the General Time Reversible (GTR) model. The numbers shown at the nodes are posterior probability values. Sequences with codes in the parentheses generated in this study. The codes in parentheses indicate the haplotype of the relevant population.
Bayesian phylogenetic tree of Tylenchulus semipenetrans isolates from citrus orchards in Fars province based on D2-D3 28S rDNA partial sequences, analyzed by the General Time Reversible (GTR) model. The numbers shown at the nodes are posterior probability values. Sequences with codes in the parentheses generated in this study. The codes in parentheses indicate the haplotype of the relevant population.

Figure 5:

Bayesian phylogenetic tree of Tylenchulus semipenetrans isolates from citrus orchards of the Fars Province based on COI mtDNA partial sequences, analyzed under the General Time Reversible (GTR) Model. Numbers shown on nodes are posterior probability values. All T. semipenetrans sequences were produced in this study. The codes in parentheses indicate the haplotype of the relevant population.
Bayesian phylogenetic tree of Tylenchulus semipenetrans isolates from citrus orchards of the Fars Province based on COI mtDNA partial sequences, analyzed under the General Time Reversible (GTR) Model. Numbers shown on nodes are posterior probability values. All T. semipenetrans sequences were produced in this study. The codes in parentheses indicate the haplotype of the relevant population.

Figure 6:

A: principal component analysis (PCA) generalized linear modeling of Tylenchulus semipenetrans haplotypes from citrus orchards of the Fars province based on COI mtDNA, and B: the corresponding phylogenetic tree, analyzed under the Hasegawa Kishino Yano (HKY) model in MEGA 7. Numbers shown on nodes are posterior probability values.
A: principal component analysis (PCA) generalized linear modeling of Tylenchulus semipenetrans haplotypes from citrus orchards of the Fars province based on COI mtDNA, and B: the corresponding phylogenetic tree, analyzed under the Hasegawa Kishino Yano (HKY) model in MEGA 7. Numbers shown on nodes are posterior probability values.

Figure 7:

Agarose gel electrophoresis verification of amplified products of ITS rDNA reactions using forward Ts2-IF and reverse Ts2-IR. The lane labeled as follows: Negative control (N), T. semipenetrans (1–3), Tylenchorhynchus sp. (4 & 5), Mesocriconema sp. (6 & 7), Hemicycliophora sp. (8 & 9), and DNA ladder (L).
Agarose gel electrophoresis verification of amplified products of ITS rDNA reactions using forward Ts2-IF and reverse Ts2-IR. The lane labeled as follows: Negative control (N), T. semipenetrans (1–3), Tylenchorhynchus sp. (4 & 5), Mesocriconema sp. (6 & 7), Hemicycliophora sp. (8 & 9), and DNA ladder (L).

Supplementary Figure 1:

Ethidium bromide-stained gels containing reaction products of ITS rDNA region of T. semipenetrans following PCR amplification with A) the primers forward 18S and reverse 21S and B) the newly designed primer set: forward Ts2-IF and reverse Ts2-IR. The amplification product of the 18S and 21S primer sets was more than 1000 bp, and these primers inefficiently amplified the target region from most of the isolates, whereas the new primer set properly amplified a smaller region of the ITS gene from all isolates of the citrus nematode.
Ethidium bromide-stained gels containing reaction products of ITS rDNA region of T. semipenetrans following PCR amplification with A) the primers forward 18S and reverse 21S and B) the newly designed primer set: forward Ts2-IF and reverse Ts2-IR. The amplification product of the 18S and 21S primer sets was more than 1000 bp, and these primers inefficiently amplified the target region from most of the isolates, whereas the new primer set properly amplified a smaller region of the ITS gene from all isolates of the citrus nematode.

Supplementary Figure 2:

Alignment results of ITS rDNA gene sequences, at the area of designed primers of common plant-parasitic nematode taxa in citrus orchards, using Mega 7. A) Forward primer search B) Reverse primer search.
Alignment results of ITS rDNA gene sequences, at the area of designed primers of common plant-parasitic nematode taxa in citrus orchards, using Mega 7. A) Forward primer search B) Reverse primer search.

Supplementary Figure 3:

Haplotype genealogy graph for COI (A) and ITS (B) sequences based on TCS network analysis. Each circle represents a haplotype.
Haplotype genealogy graph for COI (A) and ITS (B) sequences based on TCS network analysis. Each circle represents a haplotype.

Summary information of single nucleotide variations (SNV) and/or single nucleotide polymorphism (SNPs) analysis in this study for identification and genetic diversity of Tylenchulus semipenetrans populations from Fars province, Iran_

Locus No. of sites Segregating sites or SNVs SNPs No. of haplotypes Nucleotide diversity Tajima’s D Sequence conservation Min recombination
COI 603 16 11 10 Pi: 0.00767 D: 0.89661 C: 0.973 1
D2D3 676 24 12 33 Pi: 0.00535 D: −1.02740 C: 0.964 6
ITS 597 17 11 16 Pi: 0.00515 D: −0.89706 C: 0.972 2

The primers used in this study for identification and genetic diversity of Tylenchulus semipenetrans populations_

Primer code Primer sequence (5′-3′) Product size (bp) Target region References
18S TTGATTAGGTCCCTGCCCTTT 967 ITS1-5.8S-ITS2 Marek et al., 2010
21S TTTCACTCGCCGTTACTAAGG
TW81F GTTTCCGTAGGTGAACCTGC 809–841 ITS1-5.8S-ITS2 Tanha Maafi et al., 2003
AB28R ATATGCTTAAGTTCAGCGGGT
Ts2-IF TTCGAGAAACTTGGGGATTGGC 770 ITS1-5.8S-ITS2 Present study
Ts2-IR CAGGGACCTATGATCAAGTGCT T. semipenetrans specific
D2AF ACAAGTACCGTGAGGGAAAGTTG 774–777 28S D2-D3 Subbotin et al., 2006
D3BR TCGGAAGGAACCAGCTACTA
COI-F5 AATWTWGGTGTTGGAACTTCTTGAAC 790 Cytochrome oxidase subunit I Powers et al., 2014
COI-R9 CTTAAAACATAATGRAAATGWGCWACW
ACATAATAAGTATC-

Morphometrics of the second-stage juveniles of 31 populations (five specimens each) of Tylenchulus semipenetrans, collected from citrus orchards of Fars Province, Iran_ Data are expressed as mean ± standard deviation (range) of population means or specimens_ Measurements are in μm_

Character/Population code Means of populations Specimens
n 31 154
L 331 ± 12.1 (304–349) 332 ± 18 (276–376)
a 27.6 ± 1.1 (24.3–29.7) 28 ± 2 (22.4–34.7)
b 3.5 ± 0.1 (3.2–3.7) 3.5 ± .2 (3.1–4.1)
Stylet 11.4 ± 0.3 (11–11.8) 11.4 ± .4 (10.4–12.4)
Conus 6.1 ± 0.2 (5.5–6.7) 6.1 ± .4 (4.8–7.3)
Anterior end to the center of the median bulb 46.7 ± 1.6 (43.4–49.5) 46.8 ± 2.4 (39.9–53)
Pharynx length 94 ± 3.7 (85–103) 95 ± 5 (76–106.5)
MB 49.3 ± 1.2 (45.5–51) 49 ± 2 (41–55)
Anterior end to hemizonid 66.1 ± 2.2 (61.3–70.4) 66 ± 3.4 (58–77)
Anterior end to secretory-excretory pore (S. E. pore) 183 ± 7.5 (168–196) 183 ± 12 (147–222)
Anterior end to nerve ring 61.1 ± 2.3 (57.1–66.6) 61 ± 3 (51–71)
S. E. pore to genital primordium (GP) 19.4 ± 2.8 (12.8–24.9) 20 ± 4.2 (12–32)
Anterior end to GP 200 ± 6.7 (184–212) 200 ± 10 (165–222)
GP length 12.6 ± 1.6 (9.8–17.4) 13 ± 2 (8.5–21)
GP to the posterior end 118 ± 7.4 (101–130) 119 ± 11.7 (90–155)
Excretory pore from the anterior end (% of L) 56.2 ± 2.1 (53.2–60.4) 56 ± 3 (47–64)
Anterior end to GB (% of L) 60.6 ± 1.3 (58.4–63.2) 60 ± 2 (54–67)
Median bulb width 6.2 ± 0.3 (5.4–6.6) 6 ± .5 (4.9–7.5)
Median bulb length 13.2 ± 0.9 (11.9–16) 13 ± 1.4 (10–18)
Median bulb length/diam. ratio 211 ± 16.5 (182–262) 212 ± 26 (104–282)
body width (BW) in Pharynx 11.2 ± 0.4 (10.3–11.9) 11 ± .6 (9.6–13)
Max. BW 12.0 ± 0.4 (10.7–12.6) 12 ± .6 (10–14)
M 0.5 ± 0.02 (0.5–0.6) .5 ± 0 (.4–.7)
Stylet / L (%) 3.5 ± 0.1 (3.2–3.9) 3.4 ± .2 (3–4)
S. E. pore / L (%) 55.4 ± 2.1 (51.8–60) 55 ± 3 (47–64)

The sampling sites of Tylenchulus semipenetrans the corresponding GenBank accession numbers for ITS, D2-D3 expansion segments of 28S and COI mtDNA sequences obtained in this study_

Soil sample codes GPS location Locality Host (Citrus spp.) rDNA genes Mt DNA COI
latitude longitude D2–D3 ITS
25 28.6694 53.60647 Qotb Abad, Jahrom C. limetta OP723626 OP722727 OP739535
32 28.52135 53.67221 Jahrom C. sinensis OP723604 OP722708 OP739514
42 29.57487 51.73012 Ahmad Abad, Kazerun C. sinensis OP723627 OP722728 OP739536
112 28.95546 53.60143 Phase-e5, Fasa C. sinensis OP723629 OP722729 OP739537
411 29.62299 51.58779 Hasan Abad, Kazerun C. sinensis OP723616 OP722718 OP739524
678 28.99909 53.12713 Aliabad, Khafr C. aurantium OP723630 OP722730 -
682 28.98881 53.15637 Balashahr, Khafr C. sinensis - - -
698 28.51967 53.60683 Heydarabad, Jahrom C. limetta OP723597 - OP739507
707 28.53547 53.65353 Najib Abad, Jahrom C. aurantium OP723610 OP722704 OP739510
710 28.5391 53.53022 Maghsudabad, Jahrom C. limetta OP723606 OP722696 OP739515
712 28.5397 53.53049 Maghsudabad, Jahrom C. aurantium OP723631 OP722731 OP739538
716 28.47551 53.49098 Mill, Jahrom C. aurantium OP723607 OP722710 OP739516
717 28.66863 53.60608 Qotb Abad, Jahrom C. limetta OP723591 OP722698 OP739501
720 28.66878 53.6059 Yousofabad, Jahrom C. limetta OP723592 OP722699 OP739502
733 28.93138 53.60712 Kazemabad, Fasa C. sinensis OP723601 OP722705 OP739511
735 28.97311 53.63675 Banyan, Fasa C. sinensis OP723613 OP722715 OP739521
737 28.95768 53.5981 Phase-e5, Fasa C. sinensis OP723614 OP722716 OP739522
743 29.03657 53.64304 Akbarabad, Fasa C. bigaradia OP723615 OP722717 OP739523
746 28.668855 54.665161 Bagh-e Morakabat, Darab C. sinensis OP723628 OP722722 OP739529
749 28.72201 54.57227 Naghsh Shapour, Darab C. sinensis OP723632 OP722732 OP739539
755 28.67927 54.65618 Jannat Shahr, Darab C. bigaradia OP723639 OP722738 OP739546
759 28.64105 54.64284 Deh Kheyr Payin, Darab C. sinensis OP723633 OP722733 OP739540
763 28.75331 54.44562 Sharak-e Sarollah, Darab C. sinensis OP723618 OP722719 OP739526
765 28.95749 53.60026 Hasan Abad, Darab C. limetta OP723634 - OP739541
771 28.786689 54.339938 Fasarood, Darab C. aurantium OP723593 OP722700 OP739503
772 28.687654 54.647131 Zein Abad Sangi, Darab C. sinensis OP723608 OP722712 OP739517
773 28.76994 54.22515 Eij, Darab C. sinensis OP723602 OP722706 OP739512
777 28.445396 53.042906 Gandoman, Karzin C. reticulata OP723594 OP722701 OP739504
780 28.442301 53.143399 Emam Shahr, Ghir C. limetta OP723596 OP722702 OP739506
785 28.34352 53.25282 Tang-e Ruein, Ghir C. aurantium OP723636 OP722735 OP739543
789 28.452529 53.127036 Deh Beh, Ghir C. aurantium OP723609 OP722711 OP739518
793 28.285395 53.074062 Mand, Karzin C. bigaradia OP723619 OP722720 OP739527
795 28.328269 53.038029 Eslam Abad, Karzin C. aurantium OP723620 OP722721 OP739528
801 29.56717 51.75703 Ahmadabad, Kazerun C. aurantium OP723611 OP722713 OP739519
802 29.56924 51.75969 Ahmadabad, Kazerun C. aurantium OP723637 OP722736 OP739544
812 29.79435 51.57338 Ganjeii, Kazerun C. sinensis OP723640 OP722739 OP739547
818 29.7594 51.55155 Sheykhi, Kazerun C. sinensis OP723642 OP722741 OP739549
821 29.72973 51.53522 Anarestan, Kazerun C. sinensis OP723612 OP722714 OP739520
882 29.56109 51.77738 Zavali, Kazerun C. aurantium OP723638 OP722737 OP739545
908 29.00358 53.11102 Karadeh, Khafr C. aurantium OP723603 OP722707 OP739513
921 28.92434 53.33666 Khavaran, Khafr C. sinensis OP723641 OP722740 OP739548
740-2 28.89014 53.68479 Dastjeh, Fasa C. sinensis OP723617 - OP739525
Ami 28.96260 54.04458 Darab C. aurantium OP723621 OP722723 OP739530
ARE 29.61910 52.57446 Sardaran, Shiraz C. limetta OP723635 OP722734 OP739542
Beh 28.47110 53.03187 Karzin C. aurantium OP723622 OP722724 OP739531
Behz-Greenhouse 29.63544 52.52485 Eram Garden, Shiraz C. aurantium OP723623 OP722725 OP739532
Sh1 36.613791 53.258824 Behshahr1, Mazandaran C. sinensis OP723624 - OP739533
Sh2 36.625476 52.931576 Behshahr2, Mazandaran C. sinensis OP723625 OP722726 OP739534

Single nucleotide polymorphism in the alignment of the citrus nematode (Tylenchulus semipenetrans) ITS of rDNA gene partial sequences_

ITS haplotypes Isolate(s) Position of the single nucleotide variations/polymorphisms (SNVs/SNPs) on the sequences
32 37 46 71 92 122 139 151 159 161 162 188 225 354 405 423 523
T. semipenetrans JN112270.1 CD1_cl2 A G G T C A G C A C T T C T C C C
TsA (n = 20) 37, 42, 112, 678, 706, 716, 717, 733, 743, 755, 763, 777, 778, 789, 795, 821,882, 921 BEHZ & SH2 A G G T C A G C A C T T C T C C C
TsB (n = 6) 707, 710, 754, 801, 818 & ARE C A G A C A G C A C T T C T C C C
TsC (n = 1) 812 C A G T C A G C A C C T C T C C C
TsD (n = 3) 720, 773 & 802 C A A A C A C C A C T T C T C C C
TsE (n = 1) 785 C A G A C A A C A C T C T T C C C
TsF (n = 1) 759 C A G A T A A C A C T C C T C C C
TsG (n = 6) 712, 735, 737, 749, 771, & 908 A G G T C A G C A C C T C T C C C
TsH (n = 1) 25 C A G A T A A C A T T C C T C C C
TsI (n = 1) BEH A G G T C A G C A C T T T T C C C
TsJ (n = 1) AMI A G G T C A G C A C T C C T C C C
TsK (n = 1) 746 C A G A T A A C A C T C C A T C T
TsL (n = 1) 793 C A G A C A G C G C T T C T C C C
TsM (n = 1) 411 C A G T T A A C A C T C C T C C C
TsN (n = 1) 772 C A G T C A G T T C T T C T C T T
TsO (n = 1) 32 C A G A T G A C A C T C C T C C C
TsP (n = 1) 780 C G G T C A G C A C C T C T C C C

Single nucleotide polymorphism in the alignment of the citrus nematode (Tylenchulus semipenetrans) D2-D3 of 28 S rDNA gene_

D2D3 haplotypes Isolate(s) Position of the single nucleotide variations/polymorphisms (SNVs/SNPs) on the sequences
34 55 59 73 84 94 104 113 119 125 157 167 223 238 260 263 340 355 369 456 497 502 616 661
T. semipenetrans KM598334.1 ES-Jirof2 G C T C C T A G G A C G T T C C G C G A C T G A
Ts1 (n = 6) 720, 773, 32, 759, 765 & 818 G C T C C T A G G A C G T T C C G C G A C T G A
Ts2 (n = 2) BEH & 921 G C T C T T A G G A C C T T C C T C G A T T G A
Ts3 (n = 2) AMI & 812 G C T C T T A G G A C C T T C C T C G A C T G A
Ts4 (n = 1) 755 G C T C C T A G G A C G G C C C G C G G C T G A
Ts5 (n = 1) 882 G C T C C T A G G A C G T C C C G C G G C T A A
Ts6 (n = 1) 802 G C T C T T A G G A C G T T C C T C T A C T G A
Ts7 (n = 1) 785 G C T C C T A A G A C G T T C C G C G A C T G A
Ts8 (n = 1) ARE G C T C T T A G G A C C T T C C T T G A T T G A
Ts9 (n = 2) 740 & 749 G C T C C T A G G G C G T T C C G C G A C T G A
Ts10 (n = 1) 712 G C T C C T A G G G T G T T C C G C G A C T G A
Ts11 (n = 1) 678 G C T C T T A G G A C G T C C C G C G A C T G A
Ts12 (n = 2) 112 & 777 G C T C T T A G G A C C T T C T T C G A T T G A
Ts13 (n = 1) 746 G C T C C T T G G G T G T T C C G C G A C T G A
Ts14 (n = 1) 42 G C T C T T A G G A C G T T C C T C G A C T G A
Ts15 (n = 1) 25 G C T C C T A G T G C G T T C C G C G A C T G A
Ts16 (n = 9) 717, 698, 706, 716, 789, 821, 743, 763 & SH2 G C T C C T A G G A C G T C C C G C G G C T G A
Ts17 (n = 2) 733 & SH1 G C T C C T A G G A C G T C C G C G A C T G A
Ts18 (n = 1) BEHZ G C T C C T A G G A C C T T C C T C G A C T G A
Ts19 (n = 1) 795 G C T C T T A G G A C G T C C C T C G A C T G A
Ts20 (n = 2) 754 & 793 G C T C C T A G G G T G T T T C G C G A C T G A
Ts21 (n = 1) 411 G C T C C T A G G A C G T T C C G C G A C C G A
Ts22 (n = 1) 737 G C T C T T A G G A C G T T C C G C G A C T G A
Ts23 (n = 1) 735 G C T C T T A G G G T G T T C C T C G A C T G A
Ts24 (n = 1) 801 G C T C T T A G G A C C T T C C T C T A T T G A
Ts25 (n = 1) 707 G C T C T T A G G A C G T C C C G C T A C T G A
Ts26 (n = 1) 772 T C C G T T A G G A C G T T C C T C G A C T G A
Ts27 (n = 1) 710 G C T C T T A G G A C C T T C C G C G A C T G A
Ts28 (n = 1) 37 G T C C C T A G G A C G T T C C G C G A C T G A
Ts29 (n = 1) 908 G C T C C C A G G G C G T T C C G C G A C T G A
Ts30 (n = 1) 788 G C T C T T A G G A C G T C C C G C G G C T G A
Ts31 (n = 1) 780 G C T C C T A G G G T G T T C C G C T A C T G A
Ts32 (n = 1) 778 G C T C T T A G G A C C T C C C G C G A C T G A
Ts33 (n = 1) 771 G C T C C T A G G G T G T T C C G C G A C T G C

Single nucleotide polymorphism (SNPs) in the alignment of the citrus nematode (Tylenchulus semipenetrans) COI mtDNA partial gene_

COI haplotypes Isolate(s) Position of the single nucleotide variations/polymorphisms (SNVs/SNPs) on the sequences
49 250 353 385 393 406 425 448 469 481 515 532 535 562 574 580
TsI (n = 21) 771, 908, 32, 710, 801, 735, 737, 793, 795, 746, AMI, BEHZ, 25, 42, 112, 749, 759, ARE, 802, 25 & 812 C G A T A A T A T A A G A C A T
TsII (n = 10) 698, 754, 707, 733, 716, 763, BEH, 712, 765 & 921 T A A C A A T A A A A A A C A T
TsIII (n = 11) 720, 772, 773, 821, 743, 411, SH1, SH2, 785, 755 & 818 T A A T A A T T A G A A G T G T
TsIV (n = 1) 740-2 T A A C A A T T A G A A G T G T
TsV (n = 1) 789 T A A C A A T A A A A A A T G T
TsVI (n = 1) 706 C G A T A A T A T A G G A C A T
TsVII (n = 1) 780 C G A T C G T A T A A G A C A T
TsVIII (n = 1) 778 C G C T A A T A T A G G A C A T
TsIX (n = 1) 777 C G A T A A T A T A A G A C A G
TsX (n = 1) 717 C G A T A A G A T A A G A C A T

Morphometrics of males of 30 populations (five specimens each) of Tylenchulus semipenetrans, collected from citrus orchards of Fars Province, Iran_ Data are given as mean ± standard deviation (range) of population means or specimens_ Measurements are in μm_

Characters Means of populations Specimens
n 30 143
L 346 ± 13.2 (318.3–375) 347 ± 21 (296–424)
a 34.9 ± 1.9 (31.7–39.7) 34.9 ± 2.8 (29.6–44.9)
b 3.4 ± 0.2 (3.1–3.8) 3.5 ± 0.2 (2.8–4.3)
c 9.7 ± 0.5 (8.5–10.8) 9.7 ± 0.7 (8.0–12.1)
c’ 4.7 ± 0.3 (4.1–5.5) 4.7 ± 0.5 (3.5–6.1)
Stylet 8.4 ± 0.4 (7.7–9.2) 8.4 ± 0.6 (7–11.1)a
Conus 4.9 ± 0.3 (4.3–5.7) 4.9 ± 0.5 (3.5–6.4)
Anterior end to the center of the median bulb 43.7 ± 3.2 (34.2–50) 43.7 ± 4.6 (31–64)
Pharynx length 100 ± 4.8 (90–111) 101 ± 7.6 (83–123)
Anterior end to hemizonid 65.6 ± 2.8 (58.6–70.6) 65.6 ± 4.1 (52–77)
Anterior end to nerve ring 61.1 ± 3.0 (53.0–66.7) 61.1 ± 4.2 (48.5–72.5)
Secretory-excretory pore (S. E. pore) to cloaca 100 ± 6.1 (87–110) 101 ± 8.9 (75–119.5)
Anterior end to S. E. pore 231 ± 20.7 (198–279) 229 ± 44 (161–333)
S. E. pore from the anterior end (% of L) 66.9 ± 5.3 (58.0–78.) 66 ± 12 (54–91.2)
Median bulb width 4.5 ± 0.6 (3.2–5.6) 4.5 ± 0.7 (2.7–6.2)
Median bulb length 11.2 ± 0.9 (9.3–13.0) 11.2 ± 1.4 (7.1–14)
Median bulb length/diam. Ratio 252 ± 30.3 (199–328) 251 ± 41 (176–385)
Max. body width (BW) 10.0 ± 0.5 (9.1–11.0) 10.0 ± 0.8 (8.3–13)
BW in Pharynx 8.8 ± 0.4 (8.0–9.6) 8.8 ± 0.6 (7.3–10.7)
Anal BW 7.7 ± 0.5 (7.3–10.2) 7.7 ± 0.9 (6.7–16.4)
Spicules (curved median line) 16.6 ± 0.7 (15.5–17.8) 16.6 ± 1.1 (14–20)
Gubernaculum 3.7 ± 0.3 (3.1–4.3) 3.7 ± 0.5 (2.5–5.0)
Tail 36.0 ± 2.4 (33.1–42.0) 36 ± 3.4 (29–47.5)
M 0.6 ± 0.0 (0.5–0.6) 60 ± 6 (41–77)
Stylet / L (%) 2.4 ± 0.1 (2.2–2.6) 2.4 ± 0.2 (2.1–3.2)
S. E. pore / L (%) 66.9 ± 5.3 (58.0–78.7) 66 ± 12 (53.9–91.2)
Lingua:
Inglese
Frequenza di pubblicazione:
1 volte all'anno
Argomenti della rivista:
Scienze biologiche, Scienze della vita, altro
Feed RSS della rivista