Accesso libero

Morphological and Molecular Characterization of Meloidogyne arenaria (Neal, 1889) Chitwood, 1949 Populations Parasitizing Pistachio in Kerman and Khorasan Razavi Provinces, Iran

Fatemeh Shekari Mahoonaki

Fatemeh Shekari Mahoonaki

Department of Plant Protection, Faculty of Agriculture, Ferdowsi University of MashhadMashhad, Iran
Cerca questo autore su
Sciendo|Google Scholar
Mahoonaki, Fatemeh Shekari
, 
Esmat Mahdikhani Moghadam

Esmat Mahdikhani Moghadam

Department of Plant Protection, Faculty of Agriculture, Ferdowsi University of MashhadMashhad, Iran
Cerca questo autore su
Sciendo|Google Scholar
Moghadam, Esmat Mahdikhani
, 
Mohammad Zakiaghl

Mohammad Zakiaghl

Department of Plant Protection, Faculty of Agriculture, Ferdowsi University of MashhadMashhad, Iran
Cerca questo autore su
Sciendo|Google Scholar
Zakiaghl, Mohammad
, 
Mohammad Moradi

Mohammad Moradi

Pistachio Research Center, Horticulture Sciences Research Institute, Agriculture Research Education and Extension Organization (AREEO)Rafsanjan, Iran
Cerca questo autore su
Sciendo|Google Scholar
Moradi, Mohammad
 e 
Majid Pedram

Majid Pedram

Department of Plant Pathology, Faculty of Agriculture, Tarbiat Modares UniversityTehran, Iran
Cerca questo autore su
Sciendo|Google Scholar
Pedram, Majid
  
28 ott 2024
Morphological and Molecular Characterization of Meloidogyne arenaria (Neal, 1889) Chitwood, 1949 Populations Parasitizing Pistachio in Kerman and Khorasan Razavi Provinces, Iran's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Categoria dell'articolo: Research Paper
Pubblicato online: 28 ott 2024
Ricevuto: 11 mag 2024
DOI: https://doi.org/10.2478/jofnem-2024-0043
Parole chiave
© 2024 Fatemeh Shekari Mahoonaki et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1:

Photographs of root galls caused by Meloidogyne arenaria on pistachio in Kerman and Khorasan Razavi provinces, Iran. A: Irregular galls by isolate KR1-1; B: Irregular galls by KN1-1 isolate; C: Irregular galls by KhF1-2 isolate; D: Spheroid galls by KhF1-3 isolate. (All scale bars = 10 mm).
Photographs of root galls caused by Meloidogyne arenaria on pistachio in Kerman and Khorasan Razavi provinces, Iran. A: Irregular galls by isolate KR1-1; B: Irregular galls by KN1-1 isolate; C: Irregular galls by KhF1-2 isolate; D: Spheroid galls by KhF1-3 isolate. (All scale bars = 10 mm).

Figure 2:

Light microphotographs of stylet and cephalic region of Iranian population of M. arenaria (isolate KhF1-2). A: Stylet, B: Anterior body region, C: The excretory pore. (All scale bars = 10 μm).
Light microphotographs of stylet and cephalic region of Iranian population of M. arenaria (isolate KhF1-2). A: Stylet, B: Anterior body region, C: The excretory pore. (All scale bars = 10 μm).

Figure 3:

Light microphotographs of perineal patterns of studied M. arenaria populations. A, B: Isolate KR1-1; C, D: Isolate KN1-1; E, F: Isolate KhF1-2; G, H: Isolate KhF1-3; A, C, E, G: The dorsal arch is high; B, D, F, H: The dorsal arch is moderately high, phasmids are distinct. (All scale bars = 10 μm).
Light microphotographs of perineal patterns of studied M. arenaria populations. A, B: Isolate KR1-1; C, D: Isolate KN1-1; E, F: Isolate KhF1-2; G, H: Isolate KhF1-3; A, C, E, G: The dorsal arch is high; B, D, F, H: The dorsal arch is moderately high, phasmids are distinct. (All scale bars = 10 μm).

Figure 4:

Light microphotographs of anterior portion of second-stage juveniles of studied M. arenaria populations. A: Isolate KR1-1; B: Isolate KN1-1; C: Isolate KhF1-2; D: Isolate KhF1-3. (All scale bars = 5 μm).
Light microphotographs of anterior portion of second-stage juveniles of studied M. arenaria populations. A: Isolate KR1-1; B: Isolate KN1-1; C: Isolate KhF1-2; D: Isolate KhF1-3. (All scale bars = 5 μm).

Figure 5:

Light microphotographs of tail of second-stage juveniles of studied M. arenaria. populations. A: Isolate KR1-1; B: Isolate KN1-1; C: Isolate KhF1-2; D: Isolate KhF1-3, arrow shows anus. (All scale bars = 5 μm).
Light microphotographs of tail of second-stage juveniles of studied M. arenaria. populations. A: Isolate KR1-1; B: Isolate KN1-1; C: Isolate KhF1-2; D: Isolate KhF1-3, arrow shows anus. (All scale bars = 5 μm).

Figure 6:

Amplification products generated from individual females with mitochondrial primer sets C2F3/1108. A) Ladder. B, C) Unique 1100-bp product if Meloidogyne arenaria, B isolate KhF1-2, C isolate KhF1-3, D) Unique about 1600-bp product of Meloidogyne javanica.
Amplification products generated from individual females with mitochondrial primer sets C2F3/1108. A) Ladder. B, C) Unique 1100-bp product if Meloidogyne arenaria, B isolate KhF1-2, C isolate KhF1-3, D) Unique about 1600-bp product of Meloidogyne javanica.

Figure 7:

Bayesian 50% majority rule consensus tree inferred from LSU rDNA D2-D3 segment of Meloidogyne arenaria populations recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generate sequences are in bold font.
Bayesian 50% majority rule consensus tree inferred from LSU rDNA D2-D3 segment of Meloidogyne arenaria populations recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generate sequences are in bold font.

Figure 8:

Bayesian 50% majority rule consensus tree inferred from mitochondrial COII-16S segment of Meloidogyne arenaria populations recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generated sequences are in bold font.
Bayesian 50% majority rule consensus tree inferred from mitochondrial COII-16S segment of Meloidogyne arenaria populations recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

Figure 9:

Bayesian 50% majority rule consensus tree inferred from mitochondrial Nad5 segment of Meloidogyne arenaria recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generated sequences are in bold font.
Bayesian 50% majority rule consensus tree inferred from mitochondrial Nad5 segment of Meloidogyne arenaria recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

Morphometricsa of second-stage juveniles of four populations of Meloidogyne arenaria from pistachio gardens in Iran and other populations_ Measurements in μm_

This study Previous studies
Character KR1-1 KN1-1 KhF1-2 KhF1-3 Total
n 7 6 6 7 26
Body length 464±48 (378–543) 458±59 (393–537) 355±24 (335–400) 419±29 (390–460) 425±58 (335–543) 504±4.3b (392–605)
Body width 16.3±2.1 (13.5–19.0) 14.2±0.6 (13.5–15.0) 16.6±2.3 (14.5–20.0) 15.1±1.1 (14–17) 15.5±1.8 (13.5–20.0) 15.3±0.1b (13–18)
Stylet 11.0±0.7 (10–12) 11.3±0.5 (10.5–12.0) 12.0±0.9 (11–13) 11.4±0.8 (10.5–12.5) 11.4±0.8 (10–13) 11.1±0.03b (10–12)
DGO 3.5±0.6 (3.0–4.5) 3.2±0.3 (3.0–3.5) 3.3±0.4 (3–4) 3.1±0.2 (3.0–3.5) 3.3±0.4 (3.0–4.5) 3.7±0.04b (3–5)
Median bulb 57±7.2 (52.5–73.0) 54±1.8 (52–57) 52.1±3.7 (48.5–58.0) 56.1±3.1 (52.5–60.0) 55.2±4.7 (48.5–73.0) 60.9±0.43b (49.4–71.2)
Excretory pore to anterior end 74.9±8.6 (56.5–80.0) 77.1±9.2 (65–90) 81.4±6.9 (75–92) 77.9±6.9 (64–85) 77.7±7.8 (56.5–92.0) 89.8±0.56b (75.0–105.2)
Tail length 47.9±4.8 (41–53) 46.6±4.7 (38–51) 42.2±6.2 (36.5–54.0) 47.9±3.2 (45–54) 46.3±5.1 (36.5–54.0) 56.0±0.43b (44–59)
Hyaline 16.6±2.7 (13–20) 16.3±2.2 (14.0–19.5) 13.3±1.5 (12–16) 14.9±1.0 (13.5–16.0) 15.3±2.3 (12–20) 14.0±3.3c (10–21) n=17

Morphometricsa of females of four Meloidogyne arenaria populations from pistachio gardens in Iran compared with other populations_ Measurements in μm_

This study Previous studies
Character KR1-1 KN1-1 KhF1-2 KhF1-3 Total
n 7 7 7 7 28
Body length 804.3±62.9 (720–890) 849.3±46.0 (770–900) 862.9±24.3 (840–900) 875±44.3 (810–940) 847.9±51.6 (720–940) 741±115b (601–985)
Body width 542.9±46.8 (480–590) 628.6±27.3 (590–670) 578.6±27.9 (550–620) 649.3±31.7 (590–685) 599.8±53.4 (480–685) 448±89b (334–626)
Stylet 16.6±0.6 (15.5–17.0) 17.1±0.2 (17.0–17.5) 16.6±0.5 (16–17) 17.4±0.6 (17.0–18.5) 16.9±0.6 (15.5–18.5) 15.1±0.05c (13–17) n=150
DGO 4.1±0.4 (3.5–4.5) 5.4±0.7 (4–6) 4.4±0.5 (4–5) 4.9±0.4 (4.5–5.5) 4.7±0.7 (3.5–6) 4.8±0.06c (3.1–6.6) n=150
Excretory pore to anterior end 41.0±5.4 (35–49) 41.9±4.0 (39–50) 36.3±3.9 (31–42) 30.4±3.0 (25–34) 37.4±6.1 (25–50) 42.2±0.94c (18–80) n=150
Vulval slit 23.1±1.6 (21–25) 27.9±2.6 (25–33) 21.2±1.8 (19–24) 25.4±1.1 (24–27) 24.4±3.1 (19–33) 29.3±4.1 (24–37) n=9b
Vulva-anus 16.6±1.4 (15–19) 19.6±1.2 (18–21) 19.1±2.0 (16.5–22.0) 20.4±0.9 (19.0–21.5) 18.9±1.9 (15–22) 20.7±2.6 (18–21) n=9b
Interphasmid distance 27.9±2.0 (25–31) 35.0±8.3 (22–47) 28.9±2.8 (25–33) 33.3±3.5 (27–38) 31.3±5.4 (22–47) 28–31d

List of primers used for sequencing of different loci in the present study_

Locus Primers 5′ to 3′ Sequence Reference
LSU rDNA D2-D3 D2Ab ACAAGTACCGTGAGGGAAAGTTG De Ley et al. (1999)
D3B TCGGAAGGAACCAGCTACTA
COII-16S C2F3 GGTCAATGTTCAGAAATTTGTGG Powers and Harris (1993)
1108 TACCTTTGACCAATCACGCT
NADH dehydrogenase subunit 5 (Nad5) NAD5F TATTTTTTGTTTGAGATATATTAG Janssen et al. (2016)
NAD5R CGTGAATCTTGATTTTCCATTTTT

Information of geographical distribution areas of Meloidogyne arenaria in two pistachio-growing provinces of Iran and newly generated sequences in present study_

Population code Sampling area N E LSU D2-D3 GenBank accession No. COII-16S GenBank accession No. Nad5 GenBank accession No.
KN1-1 Kerman province, Nough 30′58′24.0″ 55′35′35.8″ - OR268637 OR264475
KR1-1 Kerman province, Rafsanjan 30′25′17.0″ 55′49′40.9″ - OR268638 OR264476
KhF1-2 Khorasan Razavi province, Feyzabad 34′58′36.8″ 58′42′09.8″ OR267403 OR268639 -
KhF1-3 Khorasan Razavi province, Feyzabad 34′57′14.0″ 58′39′28.1″ OR267404 OR268640 OR264477
Lingua:
Inglese
Frequenza di pubblicazione:
1 volte all'anno
Argomenti della rivista:
Scienze biologiche, Scienze della vita, altro
Feed RSS della rivista