Accesso libero

Identification, distribution, and hosts of Meloidogyne spp. infecting horticultural crops in Florida, USA with focus on Meloidogyne enterolobii

Gabrieli Riva

Gabrieli Riva

Department of Entomology and Nematology, Gulf Coast Research and Education Center, University of FloridaWimauma, USA
Cerca questo autore su
Sciendo|Google Scholar
Riva, Gabrieli
, 
Janete A. Brito

Janete A. Brito

Florida Department of Agriculture and Consumer Services, Division of Plant Industry, Nematology SectionGainesville, USA
Cerca questo autore su
Sciendo|Google Scholar
Brito, Janete A.
, 
Clemen de Oliveira

Clemen de Oliveira

Department of Entomology and Nematology, Gulf Coast Research and Education Center, University of FloridaWimauma, USA
Cerca questo autore su
Sciendo|Google Scholar
de Oliveira, Clemen
, 
Marcus Marin

Marcus Marin

Department of Plant Pathology, Gulf Coast Research and Education Center, University of FloridaWimauma, USA
Cerca questo autore su
Sciendo|Google Scholar
Marin, Marcus
, 
Mengyi Gu

Mengyi Gu

Department of Entomology and Nematology, Gulf Coast Research and Education Center, University of FloridaWimauma, USA
Cerca questo autore su
Sciendo|Google Scholar
Gu, Mengyi
, 
Hung Xuan Bui

Hung Xuan Bui

Department of Entomology and Nematology, Gulf Coast Research and Education Center, University of FloridaWimauma, USA
Cerca questo autore su
Sciendo|Google Scholar
Bui, Hung Xuan
 e 
Johan Desaeger

Johan Desaeger

Department of Entomology and Nematology, Gulf Coast Research and Education Center, University of FloridaWimauma, USA
Cerca questo autore su
Sciendo|Google Scholar
Desaeger, Johan
  
24 gen 2025
Identification, distribution, and hosts of Meloidogyne spp. infecting horticultural crops in Florida, USA with focus on Meloidogyne enterolobii's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Categoria dell'articolo: Research Paper
Pubblicato online: 24 gen 2025
Ricevuto: 23 mag 2024
DOI: https://doi.org/10.2478/jofnem-2024-0042
Parole chiave
© 2024 Gabrieli Riva et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1:

Florida's map showing the 12 counties sampled, distribution, and prevalence of each Meloidogyne species identified in this study. Out of 304 samples collected, 247 were positive for root-knot nematodes. Counties sampled and number of samples positive for Meloidogyne spp. were Alachua (2), Collier (1), DeSoto (20), Hardee (1), Hendry (1), Highlands (8), Hillsborough (171), Manatee (10), Miami-Dade (5), Palm Beach (8), and Sarasota (20). No root-knot nematodes were found in the samples collected in Charlotte County. Map was made using ArcGIS Prop software (Esri, Redlands, CA).
Florida's map showing the 12 counties sampled, distribution, and prevalence of each Meloidogyne species identified in this study. Out of 304 samples collected, 247 were positive for root-knot nematodes. Counties sampled and number of samples positive for Meloidogyne spp. were Alachua (2), Collier (1), DeSoto (20), Hardee (1), Hendry (1), Highlands (8), Hillsborough (171), Manatee (10), Miami-Dade (5), Palm Beach (8), and Sarasota (20). No root-knot nematodes were found in the samples collected in Charlotte County. Map was made using ArcGIS Prop software (Esri, Redlands, CA).

Figure 2:

Distribution of Meloidogyne species across different cropping systems found in this study.
Distribution of Meloidogyne species across different cropping systems found in this study.

Figure 3:

PCR amplification product generated using species-specific primer sets. A) Me = Meloidogyne enterolobii genomic DNA amplified using Me-F/Me-R primer set; B) Ma = Meloidogyne arenaria genomic DNA amplified using Far/Rar primer set; C) Mi = Meloidogyne incognita genomic DNA amplified using MI-F/MI-R primer set; D) Mj = Meloidogyne javanica genomic DNA amplified using Fjav/Rjav primer set; N = Water; M = 100-bp DNA ladder (New England Biolabs, MA), with the arrow indicating the position of the 500/517 bp band.
PCR amplification product generated using species-specific primer sets. A) Me = Meloidogyne enterolobii genomic DNA amplified using Me-F/Me-R primer set; B) Ma = Meloidogyne arenaria genomic DNA amplified using Far/Rar primer set; C) Mi = Meloidogyne incognita genomic DNA amplified using MI-F/MI-R primer set; D) Mj = Meloidogyne javanica genomic DNA amplified using Fjav/Rjav primer set; N = Water; M = 100-bp DNA ladder (New England Biolabs, MA), with the arrow indicating the position of the 500/517 bp band.

Figure 4:

Distribution of Meloidogyne species by crop found in this study.
Distribution of Meloidogyne species by crop found in this study.

Figure 5:

Bayesian 50% majority-rule consensus tree inferred from mitochondrial DNA DNA fragment of cytochrome c oxidase subunit II to large subunit 16S rRNA genes from C2F3/1108 primer set. Populations of Meloidogyne enterolobii obtained in this study are represented in bold. GenBank accession number proceed species and origin. *Recently reclassified as Meloidogyne luci (Stare et al., 2017).
Bayesian 50% majority-rule consensus tree inferred from mitochondrial DNA DNA fragment of cytochrome c oxidase subunit II to large subunit 16S rRNA genes from C2F3/1108 primer set. Populations of Meloidogyne enterolobii obtained in this study are represented in bold. GenBank accession number proceed species and origin. *Recently reclassified as Meloidogyne luci (Stare et al., 2017).

Figure 6:

Bayesian 50% majority-rule consensus tree inferred from mitochondrial DNA fragment of partial l-rRNA gene from TRNAH/MRH106 primer set. Meloidogyne enterolobii from this study are represented in bold. Branch lengths represent means of posterior distribution. GenBank accession number precedes species and origin. *Recently reclassified as Meloidogyne luci (Stare et al., 2017).
Bayesian 50% majority-rule consensus tree inferred from mitochondrial DNA fragment of partial l-rRNA gene from TRNAH/MRH106 primer set. Meloidogyne enterolobii from this study are represented in bold. Branch lengths represent means of posterior distribution. GenBank accession number precedes species and origin. *Recently reclassified as Meloidogyne luci (Stare et al., 2017).

Primers used in this study_

Code Meloidogyne spp. Primer Sequence 5′-3′ Gene region Reference
Far M. arenaria TCGAGGGCATCTAATAAAGG SCAR Adams et al., 2007
Rar M. arenaria GGGCTGAATATTCAAAGGAA SCAR Adam et al., 2007
JMV-1 M. hapla GGATGGCGTGCTTTCAAC IGS - SCAR Adam et al., 2007
JMV-2 M. hapla AAAAATCCCCTCGAAAAATCCACC IGS - SCAR Adam et al., 2007
Me-F M. enterolobii AACTTTTGTGAAAGTGCCGCTG IGS - rRNA Long et al., 2006
Me-R M. enterolobii TCAGTTCAGGCAGGATCAACC IGS - rRNA Long et al., 2006
MI-F M. incognita GTGAGGATTCAGCTCCCCAG SCAR Meng et al., 2004
MI-R M. incognita ACGAGGAACATACTTCTCCGTCC SCAR Meng et al., 2004
Fjav M. javanica GGTGCGCGATTGAACTGAGC SCAR Zijlstra et al., 2000
Rjav M. javanica GGCCTTAACCGACAATTAGA SCAR Zijlstra et al., 2000
1108 Nonspecific TACCTTTGACCAATCACGCT COX2-l-rRNA Powers and Harris, 1993
C2F3 Nonspecific GGTCAATGTTCAGAAATTTGTGG COX2-l-rRNA Powers and Harris, 1993
D2A Nonspecific CAAGTACCGTGAGGGAAAGTTG 28S Nunn, 1992
D3B Nonspecific TCGGAAGGAACCAGCTACTA 28S Nunn, 1992
MORF Nonspecific ATCGGGGTTTAATAATGGG IGS and tRNA-His Hugall et al., 1994
MTHIS Nonspecific AAATTCAATTGAAATTAATAGC IGS and tRNA-His Hugall et al., 1994
NAD5-F2 Nonspecific TATTTTTTGTTTGAGATATATTAG NADH dehydrogenase subunit 5 Janssen et al., 2016
NAD5-R1 Nonspecific CGTGAATCTTGATTTTCCATTTTT NADH dehydrogenase subunit 5 Janssen et al., 2016
TRNAH Nonspecific TGAATTTTTTATTGTGATTAA tRNA-His and l-rRNA Stanton et al., 1997
MRH106 Nonspecific AATTTCTAAAGACTTTTCTTAGT tRNA-His and l-rRNA Stanton et al., 1997

Meloidogyne spp_ present in Florida_

Meloidogyne spp. County Year References
M. arenaria Alachua 1888 Neal, 1889a; Chitwood, 1949
M. artielliab Palm Beach 1986 Lehman, 2002
M. christieic Seminole 1986 Golden and Kaplan, 1986
M. cruciani Alachua 1986 Garcia-Martinez et al., 1982
M. enterolobii (= M. mayaguensis) Dade 2002 Brito et al., 2002d
M. floridensis Palm Beach Alachua 2004 Handoo et al., 2004
M. graminicola Dade 2008 Brito et al., 2008
M. graminis (= Hysoperine graminis) Polk 1959 Sledge and Golden, 1964e; Whitehead, 1968
M. hapla Orange 1955 Lehman, 2002
M. haplanaria Collier 2016 Joseph et al., 2016
M. incognita Jefferson 1955 Lehman, 2002
M. javanica Orange 1955 Lehman, 2002
M. marylandi Marion 2012 Sekora et al., 2012
M. megatylab Baker 1984 Lehman, 2002
M. partityla Madison 2005 Crow et al., 2005
M. spartinae (= Hypsoperine spartinae) Flagler 1958 Rau and Fassuliotis, 1965f; Whitehead, 1968
M. thamesi Palm Beach 1952 Chitwood et al., 1952

The procedure of the PCR amplification used in this study_

Primer Response parameter (35 cycle)
Initial degeneration Degeneration Annealing Extension Final extension
C2F3/1108 95 °C, 15 min 95 °C, 45 s 55 °C, 45 s 72 °C, 60 s 72 °C, 10 min
D2A/D3B “ ” “ “ 72 °C, 10 min
TRNAH/MRH106 “ 95 °C, 30 s 50 °C, 30 s 68 °C, 60 s 68 °C, 10 min
MORF/MTHIS “ “ “ “ 68 °C, 10 min
Far/Rar “ “ 54 °C, 30 s 72 °C, 60 s 72 °C, 10 min
Fjav/Rjav “ “ 64 °C, 30 s “ 72 °C, 10 min
JMV1/JMV2 “ “ 50 °C, 30 s “ 72 °C, 10 min
Me-F/Me-r “ “ 68 °C, 30 s “ 72 °C, 10 min
MI-F/MI-R “ “ 62 °C, 30 s “ 72 °C, 10 min
NAD5-F2/NAD5-R1 94 °C, 2 min 94 °C, 60 s 45 °C, 60 s 72 °C, 90 s 72 °C, 10 min

Meloidogyne species and GenBank accession numbers of the newly DNA sequences obtained in the present study_

Sample No. Location (County) Plant host RKN species Gene region Accession number References
FL 21 Hillsborough Cucumis sativus M. arenaria NADH dehydrogenase subunit 5 OR043670 This study
FL 22 Hillsborough Solanum lycopersicum M. arenaria NADH dehydrogenase subunit 5 OR043669 This study
FL 2 Manatee Solanum lycopersicum M. enterolobii COX2 - l-rRNA OQ680023 This study
FL 3 Hillsborough Luffa cylindrica M. enterolobii COX2 - l-rRNA OQ680018 This study
FL 4 Hillsborough Ipomoea batatas M. enterolobii COX2 - l-rRNA OQ680019 This study
FL 11 Manatee Solanum lycopersicum M. enterolobii COX2 - l-rRNA OQ835723 This study
FL 13 Hendry Capsicum annuum M. enterolobii COX2 - l-rRNA OQ680020 This study
FL 14 Manatee Cucumis sativus M. enterolobii COX2 - l-rRNA OQ680021 This study
Fl 15 Hillsborough Capsicum annuum M. enterolobii COX2 - l-rRNA OQ680022 This study
FL 16 Hillsborough Capsicum annuum M. enterolobii COX2 - l-rRNA OR161827 This study
FL 13 Hendry Capsicum annuum M. enterolobii 28S rRNA OQ508955 This study
FL 4 Hillsborough Ipomoea batatas M. enterolobii tRNA-His and l-rRNA OQ680025 This study
FL 11 Manatee Solanum lycopersicum M. enterolobii tRNA-His and l-rRNA OQ835724 This study
FL 13 Hendry Capsicum annuum M. enterolobii tRNA-His and l-rRNA OQ680026 This study
FL 16 Hillsborough Capsicum annuum M. enterolobii tRNA-His and l-rRNA OQ680027 This study
Fl 17 Hillsborough Nopalea cochenillifera M. enterolobii tRNA-His and l-rRNA OQ835727 This study
FL 18 Palm Beach Capsicum annuum M. enterolobii tRNA-His and l-rRNA OQ835725 This study
FL 19 Palm Beach Capsicum annuum M. enterolobii tRNA-His and l-rRNA OQ835726 This study
FL 20 Hillsborough Cucurbita pepo M. enterolobii tRNA-His and l-rRNA OQ680028 This study
FL 2 Manatee Solanum lycopersicum M. enterolobii tRNA-His and l-rRNA OQ680024 This study
FL 3 Hillsborough Luffa cylindrica M. enterolobii tRNA-His and l-rRNA OR161828 This study
FL 24 Miami Dade Lablab purpureus M. incognita NADH dehydrogenase subunit 5 OR043668 This study
FL 25 Manatee Solanum lycopersicum M. incognita NADH dehydrogenase subunit 5 OR033166 This study
FL 26 Manatee Solanum lycopersicum M. incognita NADH dehydrogenase subunit 5 OR033167 This study
FL 27 Manatee Solanum lycopersicum M. incognita NADH dehydrogenase subunit 5 OR043667 This study
FL 28 Palm Beach Cucumis sativus M. incognita NADH dehydrogenase subunit 5 OR033164 This study
FL 29 Palm Beach Solanum lycopersicum M. incognita NADH dehydrogenase subunit 5 OR033168 This study
FL 30 Palm Beach Abelmoschus esculentus M. incognita NADH dehydrogenase subunit 5 OR033163 This study
FL 31 Hillsborough Solanum lycopersicum M. incognita NADH dehydrogenase subunit 5 OR033165 This study

Meloidogyne species found infecting different plant species in this study_

Crop Scientific name Family Total number of samplesa M. arenaria M. enterolobii M. incognita M. javanica M. hapla M. enterolobii/M. incognita
Tomato Solanum lycopersicum Solanaceae 67 (9) 4 6 22 25 0 1
Pepper Capsicum annuum Solanaceae 28 (1) 0 16 10 0 1 0
Caladium Caladium bicolor Araceae 14 14 0 0 0 0 0
Strawberry Fragaria × ananassa Rosaceae 14 (1) 0 0 0 2 11 0
Sweet potato Ipomoea batatas Convolvulaceae 14 0 14 0 0 0 0
Cucumber Cucumis sativus Cucurbitaceae 13 1 1 8 3 0 0
Cowpea Vigna unguiculata Fabaceae 11 0 1 0 10 0 0
Okra Abelmoschus esculentus Liliaceae 10 (1) 0 1 6 1 0 1
Squash Cucurbita pepo Cucurbitaceae 10 (1) 0 1 7 1 0 0
Luffa Luffa cylindrica Cucurbitaceae 9 (1) 0 7 1 0 0 0
Pumpkin Cucurbita pepo Cucurbitaceae 8 0 6 1 0 0 1
Basil Ocimum basilicum Lamiaceae 7 0 7 0 0 0 0
Cantaloupe Cucumis melo Cucurbitaceae 7 0 0 1 2 4 0
Eggplant Solanum melongena Solanaceae 6 (2) 0 4 0 0 0 0
Lettuce Lactuca sativa Asteraceae 6 (3) 0 0 3 0 0 0
Bean Phaseolus vulgaris L. Fabaceae 4 (2) 0 1 1 0 0 0
Cherry tomato Solanum lycopersicum Solanaceae 4 0 0 4 0 0 0
Lablab bean Lablab purpureus Fabaceae 4 (3) 0 0 1 0 0 0
Sugar cane Saccharum officinarum Poaceae 4 (4) 0 0 0 0 0 0
Amaranth Amaranthus sp. Amaranthaceae 3 0 0 3 0 0 0
Boniato Ipomoea batatas Convolvulaceae 3 0 0 0 0 0 0
Corn Zea mays Poaceae 3 (3) 0 0 0 0 0 0
Guava Psidium guajava Myrtaceae 3 (3) 0 0 0 0 0 0
Malabar spinach Basella alba Basellaceae 3 0 2 1 0 0 0
Parsley Petroselinum crispum Apiaceae 3 (3) 0 0 0 0 0 0
Watermelon Citrullus lanatus Cucurbitaceae 3 (2) 0 0 0 1 0 0
Artichoke Cynara cardunculus Asteraceae 2 0 0 1 1 0 0
Bok choy Brassica rapa Brassicaceae 2 0 0 1 0 0 0
Ginger Zingiber officinale Zingiberaceae 2 2 0 0 0 0 0
Golden Egg Solanum macrocarpon Solanaceae 2 0 2 0 0 0 0
Hemp Cannabis sativa Cannabaceae 2 2 0 0 0 0 0
Indigo Indigofera tinctoria Fabaceae 2 (1) 0 0 0 1 0 0
Jute Corchorus olitorius Tiliaceae 2 0 2 0 0 0 0
Perilla Perilla frutescens Lamiaceae 2 0 2 0 0 0 0
Radish Raphanus sativus Brassicaceae 2 (1) 0 0 0 1 0 0
Sugar beet Beta vulgaris Amaranthaceae 2 0 2 0 0 0 0
Sunflower Helianthus annuus Asteraceae 2 (1) 0 0 1 0 0 0
Thai basil Ocimum basilicum Lamiaceae 2 0 0 1 1 0 0
Cactus Nopalea cochenillifera Cactaceae 1 0 0 0 0 0 1
Caesar Weed Urena lobata Malvaceae 1(1) 0 0 0 0 0 0
Cauliflower Brassica oleracea Brassicaceae 1 (1) 0 0 0 0 0 0
Chrysanthemum Chrysanthemum indicum Asteraceae 1 (1) 0 0 0 0 0 0
Coriander Coriandrum sativum Apiaceae 1 0 0 1 0 0 0
Elephant ear Colocasia esculenta Araceae 1 1 0 0 0 0 0
Italian Parsley Petroselinum crispum Apiaceae 1 (1) 0 0 0 0 0 0
Jackfruit Artocarpus heterophyllus Moraceae 1 (1) 0 0 0 0 0 0
Lavender Lavandula angustifolia Lamiaceae 1 0 0 1 0 0 0
Leek Allium ampeloprasum Amaryllidaceae 1 (1) 0 0 0 0 0 0
Lily Lilium Lamiaceae 1 0 1 0 0 0 0
Mustard Brassica nigra Brassicaceae 1 0 1 0 0 0 0
Napa cabbage Brassica rapa Brassicaceae 1 0 0 1 0 0 0
Peach Prunus persica Rosaceae 1 (1) 0 0 0 0 0 0
Turnip Brassica rapa Brassicaceae 1 0 0 1 0 0 0
Water spinach Ipomoea aquatica Convolvulaceae 1 0 0 1 0 0 0
Wild tomato Solanum capsicoides Solanaceae 1 0 1 0 0 0 0
Zucchini Cucurbita pepo Cucurbitaceae 1 (1) 0 0 0 0 0 0
Lingua:
Inglese
Frequenza di pubblicazione:
1 volte all'anno
Argomenti della rivista:
Scienze biologiche, Scienze della vita, altro
Feed RSS della rivista