It is likely that alteration to the methylome of plants flown aboard the International Space Station (ISS) is one of the modalities engaged to cope with this unfamiliar environment (Paul et al., unpublished observations). Methylation occurs at the 5 position of cytosine bases and coordinates chromatin modification by recruitment of chromatin remodelers, resulting in regulation of gene expression, X-chromosome inactivation, genomic imprinting, and embryonic development (Jaenisch and Bird 2003; Mohandus et al., 1981; Li et al., 1993; Finnegan et al., 1996), and has a vast amount of relevance to all kingdoms of life. DNA methylation on cytosine bases is utilized across the genome to withdraw the availability of DNA from interactions with transcriptional machinery, generating alterations in the plants’ transcript profile and resulting physiology. Cytosine methylation is involved in a variety of biological processes in plants (Stroud et al., 2013), including development, pathogen response, temperature, and salt stress. Given that the environment of spaceflight is essentially unknown within the evolutionary history of plants, it is likely that a range of adaptation mechanisms, including DNA methylation, will occur as plants adapt to this novel environment. Therefore, the goal of this study is to establish a method for genomic DNA isolation suitable for the investigation of the methylation status, and that is consistent with accepted practices for plants that have been grown and harvested aboard the ISS.
APEX04-EPEX is an upcoming Arabidopsis plant growth experiment currently planned for launch on SpaceX-10. The focus of EPEX, which is an acronym for Epigenetic Expression, is to examine the spaceflight methylome of Arabidopsis. In preparation for that experiment, a ground-based Experiment Verification Test (EVT) was performed at Kennedy Space Center (KSC). The focus of this paper is to document the approaches used in the EVT, which tests the utilization of the resources and preservation techniques that will be available for the upcoming spaceflight experiment. In the design of this EVT, methylation mutants were included to give a base of evidence from which we could make conclusions as to the quality of the methods and approach for preserving the methylome and eventually for investigating the role of the methylome remodeling process as a response to spaceflight. The Methyltransferase 1 (MET1) and Elongator complex subunit 2 (ELP2) are key genes that encode regulators playing central roles in DNA methylation of plants (Kankel et al., 2003; Saze et al., 2003; Wang et al., 2013) and the
In the process of attaining the requirements for the EVT for spaceflight experiment APEX04, nine 0.5x phytagel plates were sown 1.5 cm from the top edge of 10 cm square plates with 12–14 dry sterilized dormant seeds (Sng et al., 2014) of either Columbia (Col-0),
Plant mass varies among genotypes. 100 mm2 Petri plates containing 11-day-old seedling of Col-0,
Root and shoot samples were blotted with kimwipes, weighed, and rinsed twice in 3 mL of wash buffer (50 mM EDTA, 25 mM EGTA) for 10 minutes. Samples were blotted again on kimwipes and transferred to mortar and pestle and ground in liquid nitrogen. 900 μL of lysis buffer (10 mM EDTA, 50 mM EGTA, 50 mM Tris), 80 μL of proteinase K (80 mg/mL), and 100 μL of 10% SDS were added and further ground. Samples were incubated at 65°C overnight. 300 μL of 5M potassium acetate was added to each sample and put on ice for 30 minutes. Each sample was then spun in a microcentrifuge at maximum speed for 5 minutes, supernatant was transferred to a new 1.5 mL microcentrifuge tube and spun for an additional 5 minutes. The supernatant was then split between two 1.5 mL microcentrifuge tubes and 800 μL isopropanol was added and the tubes were incubated at room temperature for 1 hour. Tubes were then spun at maximum speed for 10 minutes, the liquid was poured off, and the resulting pellet was air-dried for 15 minutes at room temperature. Pellets were suspended in 50 μL of TER buffer (10 mM Tris-HCl, 1 mM EDTA, 100 μg/μL RNase), split tubes were combined into one tube per sample and incubated at 60°C for 20 minutes. 100 μL of 25:24:1 phenol/chloroform/isoamyl alcohol was added to each tube, mixed, and spun at max speed for 10 minutes. The aqueous (upper) phase was transferred to a new tube and 40 μL of 7.5 M ammonium acetate (AmOAc) and 300 μL of 95% ethyl alcohol (EtOH) were added, the tubes were inverted to mix, and placed at −20°C overnight. Tubes were then spun at 4°C for 10 minutes, the EtOH and AmOAc solution was poured off, and the pellets were rinsed with 70% EtOH three times, dried for 15 minutes and suspended in 100 μL 0.25x TE buffer. This protocol is based in part on a previously developed method (Dellaporta et al., 1983).
Molecular analysis was performed to assess both the quality and quantity of DNA produced from these extractions. As an initial look into the DNA samples, 5 μL of each sample were run out beside standard DNA solutions of 50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78, 0.39, and 0.195 ng/μL on a 1% agarose gel, which generated bands within the DNA size, as visualized in Figure 2. In addition to gel electrophoresis, the DNA samples were also quantified by Qubit, generating the values displayed in Table 1, and TapeStation. For an intensive examination of DNA quality, the 2200 TapeStation instrument designed by Agilent Technologies was employed. Although there are no strict requirements upon DNA to have a certain DNA Integrity Number (DIN), as displayed in the in silico gel electrophoresis image displayed in Figure 3, for bisulfite conversion and DNA methylation analysis, the values reported by this analysis could prove useful for other downstream applications.
Agarose gel electrophoresis of gDNA extractions. Genomic DNA extraction from Col-0,
Exemplary DNA samples analyzed by TapeStation. Roots and shoots from the Col-0 ecotype EVT samples were analyzed on the Agilent 2200 TapeStation System using the Genomic DNA ScreenTape, generating concentration values and DNA Integrity Number (DIN). L–molecular weight ladder, S–CsCl purified gDNA standard.
Quantification of gDNA extractions. Qubit quantification of DNA extraction samples corresponding to Figure 2. Standard DNA with known concentration was used as positive control. The amount of roots or shoots used for DNA extraction and concentration of each DNA sample were listed.
Col-0 R1 | 10 | 30.8 |
Col-0 R2 | 10 | 14.9 |
Col-0 R3 | 10 | 26.0 |
Col-0 R4 | 10 | 23.6 |
Col-0 S1 | 10 | 27.2 |
Col-0 S2 | 10 | 25.6 |
Col-0 S3 | 10 | 27.2 |
Col-0 S4 | 10 | 29.4 |
16 | 19.8 | |
16 | 15.2 | |
16 | 20.6 | |
16 | 9.06 | |
16 | 37.2 | |
16 | 31.8 | |
16 | 30.8 | |
16 | 22.4 | |
16 | 9.24 | |
25 | 9.24 | |
25 | 13.0 | |
17 | 12.3 | |
16 | 47.4 | |
25 | 49.2 | |
25 | 36.6 | |
17 | 45.4 |
Subsequently, PCR-based DNA methylation analysis was performed to further investigate the DNA extracted from the above method and to clone exonic regions from genes of interest for methylation analysis. In order to demonstrate that DNA methylation can be investigated in RNAlater®-preserved plant material, two genes were chosen: AT2G07698 (ATPase, F1 complex, alpha subunit protein) and AT2G07687 (Cytochrome C oxidase, subunit III). These genes were chosen due to their strong differential expression generated from transcriptome analysis by Paul et al. (2013), and differential methylation based on preliminary, unpublished pilot experiments. Three genomic DNA samples from shoots of each genotype with high concentrations were selected from the four biological replicates generated from APEX04-EVT. Approximately 500 ng of each DNA sample were subjected to bisulfite conversion using the Zymo EZ DNA Methylation-Lightning®, according to the manufacturer protocol. PCR products of exon regions from the genes AT2G07698 and AT2G07687 were generated using the Zymotaq PCR system, according to the manufacturer protocol (primers used are all listed in Table 2). PCR products amplified from shoot DNA samples of Col-0,
PCR amplification products from exonic regions of AT2G07698 and AT2G07687 shoots from Col-0,
PCR primer sequences. The bisulfite primer seeker designed by Zymo Research was used to select regions to amplify from the exons of AT2G07698 and AT2G07687.
AT2G07698-F | TAAATATTTTTTTTTTATTTGTTTTTGGAG | 50.1 | 254 |
AT2G07698-R | TAAAACRAAACTATAAAAAAAAAAAAAAAAAC | 51.6 | |
AT2G07687-F | AGATAAAGTGGTTTATGATTGAATTTTAGAGG | 55.6 | 337 |
AT2G07687-R | ATCTAAAACCTCAATCCCTTTTAAAAACC | 55.9 |
We expected the DNA to be of lower concentration and amount in root samples, asthese tissues were of lower fresh mass and, in general, contain lower DNA concentration per gram of fresh mass. Given the small growth phenotype present in the
After the sequence information was produced, manual observations of the distribution of methylated cytosine bases were undertaken, generating the information displayed in Figure 5 and Figure 6. No mixed peaks were observed in the chromatogram peaks—a tribute to the uniformity of cloned amplicons in the TA colonies. For AT2G07698 and AT2G07687, the regions of +253 to +507 and +19 to +355 (the A of ATG start codon was designated +1) were analyzed, respectively. Methylation in AT2G07698 was much more bimodal and generally much lower than in AT2G07687, typically having only 0 or 1 out of 15 colonies methylated at a given position in the CG, CHG, or CHH context in wild type (Figure 5). In
DNA methylation present in AT2G07698 from gDNA samples extracted for the EVT. DNA methylation levels in the CG (A), CHG (B), and CHH (C) context in a window of ~200 b.p. in PCR detected exonic regions of AT2G07698 (+253 to + 507 from ATG) from shoot DNA samples of Col-0,
DNA methylation present in AT2G07687 from gDNA samples extracted for the EVT. DNA methylation levels in the CG (A), CHG (B), and CHH (C) context in a window of ~200 b.p. in PCR detected exonic regions of AT2G07687 (+19 to + 355 from ATG) from shoot DNA samples of Col-0,
In summary, we have generated a working method for isolating genomic DNA from RNAlater®-preserved material, and characterrizing the methylation status of DNA from RNAlater®-preserved plants. These data illustrate that novel approaches can be used to navigate some of the necessary limitations of spaceflight experiments, such as the reliance of RNAlater®-preserved material in many current ISS preservation scenarios. In addition, examinations of genotypes revealed genotype-specific differences in the methylation state of genes of interest. For DNA extraction, we deemed 10 of Col-0, 16 of