Genetic characterisation of centuries-old oak and linden trees using SSR markers
Categoria dell'articolo: Original Article
Pubblicato online: 11 mar 2022
Pagine: 58 - 68
Ricevuto: 05 lug 2021
Accettato: 08 feb 2022
DOI: https://doi.org/10.2478/ffp-2022-0006
Parole chiave
© 2022 Svitlana Bilous et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Centuries-old trees are extraordinary organisms. They not only represent a historical landscape and environmental heritage of inestimable value, but also witness a long history (Sliusar and Kushnir 2015) of environmental changes and human interventions and constitute an as yet poorly known reserve of genetic variability, which can be considered a great resource for the management programmes of forest species.
Their size, longevity and strong interactions with global biogeochemistry are some of the traits in which trees reign superlative among extant life forms (Likhanov et al. 2019).
In Ukraine, most of the centuries-old group of trees include representatives of the genera
Studies of genetic diversity by DNA markers of centuries-old populations of
In order to study the extinction of oaks, the development of methods for their preservation, as well as the practical use and preservation of natural monuments of centuries-old trees, methods of microclonal propagation of
The test materials were seven samples of centuries-old
Material characteristics
Centuries-old trees nomenclature | Location | Age [years] | Geographical coordinates | |
---|---|---|---|---|
Q1 | Yuzefinskyy oak | Hlynne, Rivne region | nearly 1000 | 51°55′33″N 27°37′86″E |
Q2 | Oak T. Shevchenko | Kyiv | more than 600 | 50°49′59″N 30°45′16″E |
Q3 | M. Rylskyi oak | Kyiv | nearly 600 | 50°38′68″N 30°51′01″E |
Q4 | Centuries-old oak in the NULES botanical garden | Kyiv | more than 200 | 50°38′16″N 30°50′28″E |
Q5 | Oak Vitovta | Kyiv | more than 400 | 50°38′42″N 30°49′73″E |
Q6 | Centuries-old oak 1 on the territory of NULES Ukraine | Kyiv | more than 400 | 50°38′38″N 30°50′53″E |
Q7 | Centuries-old oak 2 on the territory of NULES Ukraine | Kyiv | more than 400 | 50°38′37″N 30°50′61″E |
L1 | Linden T. Shevchenko | Sedniv, Chernihiv region | more than 600 | 51°63′76″N 31°56′95″E |
L2 | Linden P. Mohyla | Kyiv | more than 600 | 50°45′75″N 30°51′71″E |
L3 | Centuries-old linden tree of the Feofaniia Monument Park | Kyiv | more than 400 | 50°43′25″N 50°43′25″E |
L4 | Linden tree of St. Feodosiya Pechers′koho | Kyiv | more than 700 | 50°34′00″N 30°48′’68″E |
L5 | Centuries-old linden tree in Holosiivskyi forest | Kyiv | more than 200 | 50°72′18″ N 29°44′92″E |
L6 | Centuries-old linden tree | v. Irsha, Radomyshl district, Zhytomyr region | more than 200 | 50°38′29″ N 30°50′51″E |
Note: NULES – National University of Life and Environmental Sciences.
DNA was extracted from 100 mg of green leaves using cetrimonium bromide (CTAB) in duplicate. The resulting total DNA was dissolved in Tris-EDTA (TE buffer) (Prysiazhniuk et al. 2019). The study of molecular genetic polymorphism of
Characteristics of SSR markers for assessment of
SSR | Nucleotide sequences of primers, 5′→3′ | Motive | The expected size of the amplicons, bp |
---|---|---|---|
ssrQrZAG 7 | F: CAACTTGGTGTTCGGATCAA | (TC)17 | 150 |
R: GTGCATTTCTTTTATAGCATTCAC | |||
ssrQrZAG 11 | F: CCTTGAACTCGAAGGTGTCCTT | (TC)22 | 273 |
R: GTAGGTCAAAACCATTGGTTGACT | |||
ssrQrZAG 25 | F: GATATGAAAGATTCTTATTCCATCC | (GA)32 | 135 |
R: GTTAGAACCAATGTACCAAAGTCC | |||
ssrQrZAG 30 | F: TGCTCCGTCATAATCTTGCTCTGA | (GA)26 | 211 |
R: GCAATCCTATCATGCACATGCACAT | |||
ssrQrZAG 31 | F: CTTAGTTTGGTTGGGAAGAT | (GA)31 | 190 |
R: GCAACCAAACAAATGAAAT | |||
ssrQrZAG 44 | F: ACCCTTGTAGTCATGTTCGTTG | (GA)29 (TG)31 | 145 |
R: GAAATCTCACCTGCTCCCTATC | |||
ssrQrZAG 65 | F: CAGTGGTGTCAACTCCTCCCAG | (TC)21(TA)10 | 270 |
R: GTCAGGTGACCATTCAAACCTAGAA |
Note: F – forward primer, R – reverse primer, SSR – simple sequence repeat.
Characteristics of SSR markers for assessment of
SSR | Nucleotide sequences of primers, 5′→3′ | Motive | The expected size of the amplicons, bp |
---|---|---|---|
Tc5 | F: TTTTCATACATTTAGAGACTTTTAGCA | (AG)12 | 150 |
R: TGCATGATTTGTATGTTTAGGG | |||
Tc915 | F: ACATCGATTGTATTTCCCTTTAAC | (CT)16 | 165 |
R: GTTGTATTTTGCCCTTAACATTG | |||
Tc920 | F: AAATGTCTTCAGAGTGACTAGATGG | (GA)2(GT)15 (AG)4 | 232 |
R: TGCCTCATTATTCTCCTAATTCTC | |||
Tc927 | F: AGTCCTCCTGTCAAATGCTG | (AG)10 | 157 |
R: ATCACACTCGTTTATGACATCTTG | |||
Tc937 | F: AGCCAACCAACTTTTACAATACAG | (AG)13 | 162 |
R: AGATAAAAGCACATAAATCGATGG | |||
Tc963 | F: CTAACCCCATTCTCTTTAATTCTG | (CT)11 | 238 |
R: GCTTTCATTTCAGTTTTCCTCTAC |
Note: F – forward primer, R – reverse primer, SSR – simple sequence repeat.
Polymerase chain reaction (PCR) was performed on a T-CY amplifier (Creacon Technologies B.V., Emmen, The Netherlands). The reaction mixture with a volume of 10 μl for PCR and the amplification parameters for
Composition of reaction mixture for PCR of
Components | Final concentration | |
---|---|---|
PCR buffer* | 1× | 1× |
MgCl2 | 1.5 μM | 2 μM |
dNTP (dATP, dTTP, dGTP, dCTP) | 100 μM | 200 μM |
Polymerase Taq | 1 U | 0.5 U |
Primer (F) | 1 μM | 0.2 μM |
Primer (R) | 1 μM | 0.2 μM |
DNA | 50 ng | 50 ng |
Note:
10 μM Tris-HCl, pH 9.0; 50 μM KCl; 0.01% Triton X-100; F – forward primer, R – reverse primer, PCR – polymerase chain reaction.
PCR protocol for
Step name | ||||
---|---|---|---|---|
parameters [°C/time] | cycle number | parameters | cycle number | |
Initial denaturation | 95/3 min | 1 | 95/3 min | 1 |
Denaturation | 94 (89)*/30 s | 33* | 94/30 s | 35 |
Annealing | 50/30s | 54**/1 min | ||
Extension | 72/30 s | 72/30 s | ||
Final extension | 72/3 min | 1 | 72/3 min | 1 |
Note:
first 10 cycles are carried out at 94°C, followed by 23 cycles at 89°C;
60°C for Tc927; PCR – polymerase chain reaction.
The amplification reaction products were visualised by electrophoresis in 2% agarose gel in 0.5× Tris-borate-EDTA (TBE) buffer solution according to the conventional method with ethidium bromide (Tkachyk 2015). Electrophoresis was performed for 1.5 h at an electric field strength of 5 V/cm. The size of the fragments was determined using the software TotalLab 12.0.
To characterise the genetic structure of the studied genotypes, the frequencies of identified alleles and polymorphism information content (PIC) were calculated (Sivolap et al. 1998). For the purpose of cluster analysis, a matrix was constructed, in which the presence/absence of a specific allele was denoted as 1/0, respectively. The method of hierarchical clustering with Euclidean measure of distance using the computer program STATISTICA 12.0 (trial version) was applied for analysis. Clustering of the studied genotypes was performed using the unweighted pair group average (Ermantraut et al. 2007; Drozdov 2010). Correlations between the test samples by SSR markers and their geographical location were determined by genetic distances using the Mantel test via a computer program XLSTAT 2018 (trial version) (Lobo et al. 2018; Tommasini et al. 2003; Legendre and Fortin 2010; Diniz-Filho et al. 2013; Klyachenko and Prysiazhniuk 2018).
As a result of electrophoretic separation of PCR products, amplicons of the expected size were obtained for samples of
Figure 1
Results of PCR testing of samples of common oak with marker: A – ssrQrZAG 11: 1 – Yuzefin oak; 2 – Shevchenko oak; 3 – Rylskyi oak; 4 – centuries-old oak in the botanical garden of the NULES; 5 – Vytautas oak; 6 – centuries-old oak on the territory of NULES Ukraine; B – ssrQrZAG 65: 1 – Rylskyi oak; 2 – centuries-old oak in the NULES botanical garden; 3 – Vytautas oak
Note: M – molecular weight marker 100-bp DNA ladder O’GeneRuler (Thermo Scientific), NULES – National University of Life and Environmental Sciences, PCR – polymerase chain reaction.

Sizes of obtained alleles for
SSR | Allele size, bp | ||||||
---|---|---|---|---|---|---|---|
Q1* | Q2 | Q3 | Q4 | Q5 | Q6 | Q7 | |
ssrQrZAG 7 | 132 | 120, 140 | 132 | 152 | 152 | 140 | 146 |
ssrQrZAG 11 | 300 | 332 | 268, 300 | 290 | 290 | 268, 300 | 290 |
ssrQrZAG 25 | 116 | 206 | 206 | 206 | 194 | 158, 206 | 112, 158 |
ssrQrZAG 30 | 204, 226 | 212, 230 | 182 | 192 | 212 | 192, 212 | 204 |
ssrQrZAG 31 | 146, 182 | 146, 182 | 140, 158 | 174 | 182 | 158 | 146, 182 |
ssrQrZAG 44 | 116, 156 | 124, 180 | 144 | 144, 180 | 144 | 156, 216 | 156 |
ssrQrZAG 65 | 272, 320 | 264, 312 | 312 | 312, 340 | 296, 320 | 396 | 388 |
Note:
Q1 – Yuzefinskyy oak; Q2 – oak T. Shevchenko; Q3 – M. Rylskyi oak; Q4 – centuries-old oak in the NULES botanical garden; Q5 – oak Vitovta; Q6 – centuries-old oak 1 on the territory of NULES Ukraine; Q7 – centuries-old oak 2 on the territory of NULES Ukraine; NULES – National University of Life and Environmental Sciences, SSR – simple sequence repeat.
It was found out that one allele of 300, 332 and 290 bp was identified in the specimens of Yuzefin oak, Shevchenko oak and centuries-old oak in the National University of Life and Environmental Sciences (NULES) botanical garden. Rylskyi oak is polymorphic by this marker and contains two alleles of 268 and 300 bp. It has been found that the allele with a size of 332 bp was unique by the marker ssrQrZAG 11 for the tested samples of common oak and was identified only in Shevchenko oak. As regards the marker ssrQrZAG 65, one allele with a size of 312 bp was identified in Rylskyi oak. Also, two alleles of 312 and 340 bp and 396 and 320 bp, respectively, were revealed in specimens of centuries-old oak in the NULES botanical garden and Vytautas oak. The sizes of alleles, which were obtained for common oak samples, are presented in Table 6.
According to the results of testing of small-leaved linden samples by SSR markers, three alleles were identified in the sample of P. Mohyla linden (154, 174 and 180 bp) among the studied samples of small-leaved linden by one Tc5 marker (Tab. 7).
Sizes of obtained alleles for
SSR | Allele size, bp | |||||
---|---|---|---|---|---|---|
L1* | L2 | L3 | L4 | L5 | L6 | |
Tc927 | 152, 168 | 152 | 152 | 152, 168 | 152 | 152 |
Tc5 | 154 | 154, 174, 180 | 154 | 158 | 154 | 154, 180 |
Tc915 | 154 | 154, 168 | 154 | 154, 174 | 182 | 168 |
Tc920 | 218, 232 | 224, 240 | 218, 232 | 232 | 232, 252 | 252 |
Tc937 | 152 | 152 | 152 | 162 | 162 | 162 |
Tc963 | 246 | 246 | 238 | 238 | 246 | 246 |
Note:
L1 – T. H. Shevchenko
For small-leaved linden samples, all identified alleles are presented in Table 7.
One allele was identified in samples of T.H. Shevchenko linden and century-old linden of the Feofaniia Monument Park; sizes of the identified alleles were 154 and 158 bp, respectively. Two alleles sized 154 and 180 bp were identified in a sample of the linden of St. Theodosius of Pechersk. According to the Tc915 marker, the 154 bp allele has the highest frequency (0.50) among markers with a PIC greater than 0.60. As can be seen from Figure 1b, this allele is characteristic of samples of T. H. Shevchenko linden, P. Mohyla linden, the linden of St. Theodosius of Pechersk and the centuries-old linden of the Feofaniia Monument Park. It was determined that the samples of P. Mohyla linden and the centuries-old linden of the Feofaniia Monument Park turned out to be polymorphic and had another allele of 168 and 174 bp. Characteristics of all obtained alleles by the studied markers for the samples of common oak and small-leaved linden are shown in Table 8. According to the data obtained for the studied common oak samples, the most polymorphic was the marker ssrQrZAG 65, the PIC for which was 0.84.
Characteristics of the obtained alleles by SSR markers for the samples of
SSR | Number of alleles | Allele size range | Alleles’ frequency | PIC |
---|---|---|---|---|
ssrQrZAG 7 | 5 | 120–152 | 0.07–0.29 | 0.77 |
ssrQrZAG 11 | 4 | 268–332 | 0.14–0.43 | 0.69 |
ssrQrZAG 25 | 5 | 112–206 | 0.07–0.50 | 0.68 |
ssrQrZAG 30 | 6 | 182–230 | 0.07–0.29 | 0.80 |
ssrQrZAG 31 | 5 | 140–182 | 0.07–0.36 | 0.76 |
ssrQrZAG 44 | 6 | 116–216 | 0.07–0.36 | 0.76 |
ssrQrZAG 65 | 8 | 264–396 | 0.07–0.29 | 0.84 |
Tc5 | 4 | 154–180 | 0.08–0.58 | 0.60 |
Tc915 | 4 | 154–182 | 0.08–0.50 | 0.65 |
Tc920 | 5 | 218–252 | 0.08–0.25 | 0.72 |
Tc927 | 2 | 152–168 | 0.17–0.83 | 0.28 |
Tc937 | 2 | 152–162 | 0.5 | 0.50 |
Tc963 | 2 | 238–246 | 0.33–067 | 0.44 |
Note: PIC – polymorphism information content, SSR – simple sequence repeat.
The lowest PIC value was observed for the marker ssrQrZAG 25 – 0.68. It was determined that for the ssrQrZAG 7 marker, only one sample (Shevchenko oak) is heterozygous and contains two alleles (120 and 140 bp, respectively). Other samples of common oak are homozygous by this marker. Two to four heterozygotes are identified by other markers. Frequencies of the identified alleles range from 0.07 to 0.50. Craciunesc et al. (2011) investigated the genetic diversity of Finnish common oak populations by 15 SSR markers. Scientists have identified from 3 to 15 alleles depending on the marker.
Thus, 15 alleles were identified by the marker ssrQrZAG 11, which characterises it as the most polymorphic. In our studies, four alleles were revealed by this marker, the frequencies of which were not distributed evenly enough, as indicated by the low PIC value. As to the marker ssrQrZAG 25, which demonstrated the lowest PIC value in our studies, 13 alleles were identified in 38 tested PIC genotypes in studies by Steinkellner et al. (1997). Kampfer et al. (1998) studied the polymorphism of
For small-leaved linden samples, the most polymorphic was the marker Tc920 with the PIC value of 0.72. The frequencies of alleles by this marker vary from 0.08 to 0.25. The lowest PIC value was found for the marker Tc927, as evidenced by the uneven distribution of allele frequencies (from 0.17 to 0.28). All studied samples of small-leaved linden were homozygous by Tc937 and Tc963 markers. It was noted that low PIC values (0.50 and 0.44, respectively) were also obtained for these markers. Thus, markers Tc5, Tc915 and Tc920 with PIC values from 0.51 to 0.72 proved to be the most effective for determining the polymorphism of centuries-old linden trees. Studies conducted by Phuekvilai and Wolff (2013) showed that 15 SSR markers were effective for determining the polymorphism of
In our studies of
To assess the degree of genetic proximity of
Figure 2
Cluster distribution of
Note: Q1 – Yuzefin oak; Q2 – Shevchenko oak; Q3 – Rylskyi oak; Q4 – centuries-old oak in the NULES botanical garden; Q5 – Vytautas oak; Q 6 and Q7 - centuries-old oak near the territory of NULES Ukraine; NULES – National University of Life and Environmental Sciences, SSR – simple sequence repeat.

Figure 3
Cluster distribution of
Note: L.1 T.H. Shevchenko

As a result of cluster analysis of
The closest were the samples included in one cluster, and the value of genetic distances between them was 3.32 (samples of Rylskyi oak and the centuries-old oak on the territory of NULES Ukraine, and the centuries-old oak in the NULES botanical garden and Vytautas oak).
The value of genetic distances between the sample of Shevchenko oak and other samples was 3.87–4.36. The most distant by the tested SSR markers were the samples of Yuzefin oak and the centuries-old oak in the NULES botanical garden; the value of genetic distances was 4.47.
Some scientists investigated the genetic diversity of
According to the cluster distribution of small-leaved linden samples by six SSR markers, two clusters were obtained. The first cluster was formed by samples of T.H. Shevchenko
According to the obtained data, the closest samples were the samples of T. H. Shevchenko
In order to check the correlations between pairs of samples of
Figure 4
Relationship between genetic distances of

Figure 5
Relationship between genetic distances of

As a result of the analysis, the calculated significance level
Based on the obtained data, it was determined that the calculated
Thus, the obtained data indicate the absence of correlations between the
Studies by Hutchison and Templeton (1999) have shown the use of correlation analysis for assessment of the relative influence of gene flow and drift on the distribution of genetic variability inside and outside a certain region. Studies of
Our studies characterise individual trees of
According to the results of studies of seven samples of
It has been determined that there is no correlation between the studied samples of