Cardiovascular diseases constitute to 49% of deaths in Poland. The last stage of majority of them is chronic heart failure (HF), defined as a syndrome of clinical symptoms, caused by irreversible damage of cardiomyocytes that prevent proper perfusion of the internal organs and leading to multi-organ end-stage failure. Additionally to the efforts to improve the diagnostic methods and increase the effectiveness of treatment with „traditional” approaches, more and more attention is given to the possibility of utilization of the regenerative potential of human organism, which, according to numerous scientific reports, appears to be also noticeable in the heart muscle tissue. Nevertheless, the scientific world still has not created a clear answer about the intrinsic regenerative capacity of the cardiac muscle. On the one hand, the role of cardiac progenitor cells (CPCs) in tissue self-renewal by CM replenishment is shown [1,2,3], and on the other hand studies demonstrated that the adult heart lacks a predetermined cardiomyocyte-producing stem cell and mammalian cardiac regeneration is not mediated by
Epigenetic mechanisms play an essential role in eukaryotic gene regulation by modifying chromatin structure, which in turn modulates gene expression without changes in the DNA sequence [6]. There are few processes that have been most frequently implicated in epigenetic control, nevertheless DNA methylation seems to be the most common epigenetic mechanisms of gene regulation [7]. The methylation of mammalian genomic DNA, referred as addition of a methyl group to the fifth position of the cytosine pyrimidine ring, predominantly at CpG dinucleotides, is catalyzed by DNA methyltransferases (DNMTs) [8]. Three different DNMTs (DNMT1, DNMT3A, and DNMT3B) mediate DNA methylation, and they have different functions that complement each other during methylation [9]. Because it is well established that this epigenetic modification may affect chromatin accessibility, and the DNMTs characteristic in cardiac muscle culture remains poorly understood, thus we decided to focus our research on the DNA methyltransferases mRNA expression levels in cardiac muscle cells
We studied DNMT1, DNMT3A, and DNMT3B transcript levels in different stages of primary
Porcine (
The right atrial appendage (right auricle) was extracted from the delivered material, washed in icecold PBS solution, to remove the blood and, in the next stage, after the two-step mincing in petri dishes the tissue undergo enzymatic digestion in DMEM + collagenase type II (2mg/mL) solution conducted in 37°C for 40 min. After the end of digestion, the remaining tissue will be separated with nylon strainers of 70μm pore size. The filtrate (containing cells of interest) will be centrifuged (5 min, 200 x g, RT), in order to remove the remaining collagenase from the cell environment. Cell pellet obtained was washed with the PBS buffer and then placed in culture medium (DMEM/F12, Sigma-Aldrich), 20% FBS (Foetal Bovine Serum, Gibco), 10% HS (Horse Serum, Gibco), EGF (20ng/ml; Sigma-Aldrich), 1% P/S. The cells were cultured at 37 °C in a humidified atmosphere of 5% CO2. The culture medium was changed every three days.
Total RNA from all of the samples (both before and after IVM) was isolated according to the method published by Chomczyński and Sacchi [10] employing TRI reagent (Sigma-Aldrich; Merck KGaA). RNA integrity was determined by denaturing agarose gel (2%) electrophoresis, and then, the RNA was quantified by measuring the optical density (OD) at 260 nm (NanoDrop spectrophotometer; Thermo Scientific, Inc.). The RNA samples were re-suspended in 20–40 μl of RNase-free water and stored at −80°C. RNA samples were reverse-transcribed into cDNA using RT2 First Strand kit (Qiagen, Hilden, Germany), according to the manufacturer's protocol. Then, 500 ng of an RNA sample was used for reverse transcription.
Determination of the transcript levels for DNMT1, DNMT3A and DNMT3B was conducted using a Light Cycler® 96 Real-Time PCR System, Roche Diagnostics GmbH (Mannheim, Germany) with EvaGreen as a detection dye. Levels of analyzed transcripts were standardized in each sample, in reference to
Oligonucleotide sequences of primers used for RT-qPCR analysis
DNMT1 | F | GTGAGGACATGCAGCTTTCA | 211 |
R | AACTTGTTGTCCTCCGTTGG | ||
DNMT3A | F | CTGAGAAGCCCAAGGTCAAG | 238 |
R | CAGCAGATGGTGCAGTAGGA | ||
DNMT3B | F | ACAGGTCGGCTCTTCTTTGA | 245 |
R | AAAGCCCCTCGTTACCTGTT |
The normality of the observed data distribution was assessed by the Shapiro–Wilk test, followed by the Mann–Whitney U test to identify statistically significant differences between the compared mean values.
The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals. As the research material is usually disposed of after slaughter, being a remnant by-product, no Ethical Committee approval is needed for this study.
In the present study, employing RT-qPCR to compare the mRNA levels, DNMT1, DNMT3A, and DNMT3B transcripts in primary
RT-qPCR quantitative relative changes of analyzed DNMTs presented in a form of a bar graph. The graph shows the relative changes in gene expression results for 7, 15 and 30 days of cultivation, in relation to the transcript levels obtained from beginningo of our culture (0d). FC was presented in its logarithmic form to provide clear comparability of the results
Comparision of ΔCT values for analyzed DNMTs mRNA levels in different stages of culture. All calculations were made in relation to the expression levels for the individual genes at the time of beginning of the culture
Despite significant advances in medical therapy and prophylactic strategies, the prognosis of millions of patients with chronic heart failure (HF) remains poor. HF is an end stage of many cardiac diseases, particularly coronary artery disease (CAD) and cardiomyopathies. Available therapeutic options for HF individuals are still suboptimal, therefore, many hopes are associated with a new therapeutic approaches that uses the intrinsic regenerative potential of the heart tissue. This is why understanding the molecular mechanisms underlying the functioning of the myocardial cell population becomes a key aspect. Epigenetic alternations, including DNA methylation, undoubtedly play a key role in the activity of mammalian cells.
The mammalian DNA methyltransferases family consist of DNMT1, DNMT2, DNMT3A, DNMT3B and DNMT3L. The studies presented, focus on the analysis of mRNA expression levels for DNMT1, DNMT3A, and DNMT3B, because DNMT3L is primarily restricted to early embryogenesis and DNMT2 functions to methylate RNA [11]. Among group of the DNMTs, two ways for establishment and mitotic inheritance of tissue-specific methylation patterns are distinguished. DNMT3A and DNMT3B catalyze
Since cardiomyocytes were commonly considered to be terminally differentiated and do not proliferate significantly under physiological conditions [1], epigenetic mechanisms—among them DNA methylation—seemed of little importance for heart disease. However, an increasing number of studies in recent years indicate, that in cardiomyocytes, dynamic CpG methylation is not only predominantly confined to postnatal development, but also occurred in experimental heart failure [15]. Gilsbach et al. employed cardiomyocytes of neonatal, adult healthy and adult failing hearts and demonstrated large genomic regions that are differentially methylated during cardiomyocyte development and maturation [15]. These findings unquestionably indicated, in contrast to the established views, that DNA methylation is a highly dynamic process during postnatal growth of cardiomyocytes and their adaptation to pathological stress in a process tightly linked to gene regulation and activity. Other investigators [16], also found evidences supporting dynamic nature of DNA methylation. In hearts from patients with end-stage cardiomyopathy undergoing heart transplantation, intra-genic CpG islands displayed higher methylation levels compared to control [16]. In our study, using RT-qPCR approach, we found increased expression of DNMT1 and DNMT3A mRNA levels during long-term
Although, cardiomyocytes show low rates of DNA synthesis postnatally [3], and DNMT1, as the maintenance methyltransferase, does not emerge as a key player of the observed hypermethylation, some research found that DNMT1-mediated DNA methylation is increased in right ventricular fibroblasts (RVfib) in pulmonary arterial hypertension (PAH) [17]. These studies demonstrated, that DNMT1 via methylation activate HIF-1α (hypoxia-inducible factor) and cause a proliferative, fibrogenic RVfib phenotype. Furthermore, HIF-1α upregulates PDK (pyruvate dehydrogenase kinase) expression and increases fibrogenic cytokines, like TGF-β1 (transforming growth factor-beta-1) and CTGF (connective tissue growth factor). This pathway additionally promotes collagen production and right ventricular fibrosis in PAH [17]. In the present study, we also found increasing DNMT1 expression during
The assumption that DNMT3A and DNMT3B are responsible for
The results of transcriptomic studies using RT-qPCR presented in this manuscript indicate an active process of methylation in cardiac muscle cells cultured under