Accesso libero

Regulatory roles of lncRNA PANDAR in breast cancer cell proliferation

INFORMAZIONI SU QUESTO ARTICOLO

Cita

Breast cancer is a major malignancy affecting women worldwide [1]. Annually, approximately 1.4 million new breast cancer cases are recorded, with 410,000 women eventually dying, accounting for 14.1% of cancer-related deaths in female patients. Treatment for breast cancer has been reported to fail in 25%–40% of breast cancer patients within 5 years due to distant metastasis [2], which is the leading cause of death in affected individuals. Therefore, exploring the mechanisms that increase malignancy and poor treatment response is required to discover new biomarkers and treatment approaches.

Epithelial-mesenchymal transition (EMT) is a process by which epithelial cells undergo transformation to acquire mesenchymal features, generating malignant cells harboring stem cell-like properties, also known as cancer stem cells (CSCs), including migration and invasion, reduced apoptosis and senescence, and drug resistance [3], thus facilitating the metastatic cascade. A recent study found that the mesenchymal state is responsible for a lower degree of tumor cell differentiation, which is related to poor prognosis in patients [3]. EMT occurs throughout different stages of embryonic development and is induced via a panel of specific transcription factors. A previous review discussed the relationship between EMT-inducing transcription factors and cadherin modulation—these involving E-cadherin (E-cad) and N-cadherin (N-cad) through embryonic development and cancer progression [4]. A recent review indicated that a hallmark of EMT is the upregulation of N-cad followed by the downregulation of E-cad [5].

Long noncoding RNAs (lncRNAs) constitute a group of small RNAs with >200 bp and without an open reading frame, which inhibit the expression of downstream genes predominantly by affecting the activity of the upstream promoter region [6]. lncRNAs can contribute critically to the pathogenesis and development of breast cancer [7]. For example, the lncRNA H19 promotes breast cancer cell proliferation, clone formation, and metastasis, and further generates CSCs [8]. However, studies assessing the regulation of the EMT process by lncRNAs in breast cancer are scarce. The promoter of the gene for cyclin dependent kinase inhibitor 1A, CDKN1A anti-sense DNA damage-activated RNA (PANDAR; NCBI gene ID: 101154753) is a noncoding RNA located on chromosome 6p21.2, whose abnormal expression is involved in the pathogeneses of various cancers [9, 10]. By inhibiting p16INK4A expression, PANDAR modulates G1/S arrest in breast cancer cells [11]. Additionally, high PANDAR levels in colon cancer predict poor patient prognosis and promote metastasis through EMT [12]. lncRNAs also participate in EMT, maintaining the properties of CSCs in breast cancer. Increasing evidence suggests lncRNAs have critical regulatory functions in cancer cell proliferation and apoptosis, cell cycle arrest, metabolism, angiogenesis, invasion, metastasis, and disease relapse [13, 14, 15, 16, 17, 18].

Here, we assessed the effects of PANDAR on EMT and proliferation in breast cancer cells.

Methods
Cell culture

Human breast invasive ductal carcinoma Michigan cancer foundation 7 (MCF-7) cells were obtained from the American Type Culture Collection (catalog No. HTB-22), HEK-293T cells (catalog No. GNHu17) were obtained from the China Center for Type Culture Collection of the National Collection of Authenticated Cell Cultures Cell Bank affiliated with the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, and these were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco) containing 10% fetal bovine serum (Gibco), penicillin (100 U/mL), and streptomycin (100 mg/mL). Cells were incubated in culture medium under a humidified atmosphere of 5% CO2 in air at 37 °C. Cell identity had been confirmed by short tandem repeat DNA profiling, and PCR had been used to confirm the absence of any mycoplasma contamination.

Plasmid construction

The genes of lncRNAs, including TCONS00068220 (XR_928848.2), which is the same gene as LOC105375819, for HOX transcript antisense RNA (HOTAIR, NR_003716.3), ciR-has_circ_0001073, BX647792, and PANDAR (NR_109836.1), were amplified from human genomic DNA isolated from MCF-7 cells. lncRNA were then cloned into the pLVX-Puro vector to construct a series of lncRNA plasmids. Circular RNA ciR-has_circ_0001073 was cloned into pLCDH-ciR vector. Primer sequences are listed as follows: HOTAIR forward (F): CAAGCTTCGAATTACGAATTCGACTCGCCTGTGCTCTGGAGCTTG; HOTAIR reverse (R): TTATCTAGAGTCGCGGGATCGGAAAATGCATCCAGATATTAATAT; BX647792 F: CAAGCTTCGAATTACGAATTCGGCCAGAAGGGGAGGAAATTGGAA; BX647792 R: TTATCTAGAGTCGCGGGATCGCCAGTTTTTCCAACTTCCCCTTTC; LOC105375819 F: CAAGCTTCGAATTACGAATTCCCGACTTTCACTTATCAGACCTTG; LOC105375819 R: TTATCTAGAGTCGCGGGATCGGGTGAGCAGTTTTTATTAACCTGT; PANDAR F: CAAGCTTCGAATTACGAATTCTTTCAGGAATGCCGCAGATGTACA; PANDAR R TTATCTAGAGTCGCGGGATCGCAGTGGCTCACGCCTGTAATCTCA; ciR-hsa_circ_0001073 F: ACCTCCATAGAAGATTCTAGAGAGTTCTAAAATTAAACTATGTGG; ciR-hsa_ circ_0001073 R: CTCAGCGCCACAGCAGAATTCGTTAATTGAACAGATTTTATTTTA.

Dual-luciferase reporter assay

The human and mouse E-cad gene promoters (Nos. 42081 and 61798) reporter plasmids were purchased from Addgene. lncRNA expression vectors, reporter plasmid containing mouse E-cad promoter, and internal control plasmid pRL-TK were cotransfected into HEK-293T cells. The pRL-TK vector served as a reference for normalizing transfection efficiency. At 48 h after transfection, dual-luciferase assays were performed by using a dual-luciferase reporter assay kit (Promega), according to the manufacturer's instructions. The ratio of firefly-to-Renilla luciferase activity was calculated and results were normalized to the corresponding negative control. Data are represented as the mean ± standard deviation (SD) of triplicate assays. Significant differences from controls are indicated by *P < 0.05, **P < 0.01.

Lentivirus packaging and stable cell line construction

LentiX-293 cells were seeded into a 10 cm dish at 2.5 × 106 cells/dish. On the next day, a mixture of 5 μg pLVX-PANDAR or pLVX-Puro, 3.75 μg psPAX2 (catalog No. 12260; Addgene), and 1.25 μg pMD2.G (catalog No. 12259; Addgene) were diluted into 1 mL opti-MEM medium (Invitrogen); then, 30 μL PEI solution (1 mg/mL, catalog No. 23966; Polyscience) was added and mixed thoroughly. The mixture was incubated at room temperature for 25 min to prepare the transfection complexes. Then, the mixture was added dropwise into the abovementioned LentiX-293 cells. At 48 h after transfection, the supernatants were collected and centrifuged at 40,000 × g to collect lentivirus pellets. We used 1 mL DMEM medium to resuspend the lentivirus. MCF-7 cells (1 × 106 cells in a 60 mm dish) were infected with each lentivirus at a multiplicity of infection (MOI) of 1. At 48 h after infection, stable cell lines were selected by adding 1 μg/mL puromycin (Sigma).

RNA extraction and qRT-PCR

Total RNA was extracted from cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The cDNA was synthesized through reverse-transcription reaction with Rever-Tra-Ace-α-Transcriptase (Toyobo) and subsequently amplified by PCR using SYBR Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa Bio). The primer sequences used in quantitative real-time polymerase chain reaction (qRT-PCR) are listed as follows: GAPDH QRT F: CCCATGTTCGTCATGGGTGT; GAPDH QRT R: TGGTCATGAGTCCTTCCACGATA; PANDAR F: TCAGGAATGCCGCAGATGTA; PANDAR R: GACCGTGTCTGGAGGATGCC.

Immunoblotting

The harvested cells were pelleted and resuspended in sodium dodecyl sulfate (SDS) lysis buffer (50 mM pH 6.8 Tris-HCl, 1% SDS, 10% glycerol, and 20 mM dithiothreitol) and incubated on ice. The lysates were centrifuged at 8,000 × g (5 min, 4 °C). Subsequently, proteins were separated by 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and electro-transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, USA). After blocking nonspecific binding sites with 5% nonfat milk for 1 h at ambient room temperature, they were incubated overnight at 4 °C with mouse monoclonal primary antibodies against E-cad (1:1,000; catalog No. sc-21791, antibody ID AB_626777), N-cad (1:1,000; catalog No. sc-59987; antibody ID AB_781744), and β-actin (1:1,000, catalog No. sc-47778; antibody ID AB_2714189) (Santa Cruz Biotechnology). Then, horseradish peroxidase (HRP)-linked goat secondary anti-mouse antibodies (1:2,000; catalog No. A0216; antibody ID AB_2860575; Beyotime, China) were added at ambient room temperature and incubated with the proteins transferred to the membrane for 1 h. Immunoreactive signal was developed and visualized with enhanced chemiluminescence (ECL) reagents (Millipore).

CCK-8 assay

A cell counting kit-8 (CCK-8) was used to assess cell viability. Briefly, MCF-7 stable cell line overexpressing PANDAR or control cells were seeded into 96-well plates at 2 × 103 cells/well. Then, 10 μL CCK-8 reagents (Solarbio, China) were added per well for the indicated time, followed by further incubation at 37 °C for 2–4 h. Optical density was measured at 450 nm on a microplate reader (Bio-Rad).

Statistical analysis

Data are shown as means ± SD calculated by WPS Office 2019. The empirical data obtained from all experiments were fitted to histograms using GraphPad Prism 7 software. The experiments were performed in triplicate and repeated (more than once). A Student t test (two-tailed) was performed to compare parametric data. Differences with P < 0.05 were considered significant.

Results
TCONS00068220 and PANDAR regulate E-cad gene transcription

E-cad, a biomarker of epithelial cells, is downregulated in the EMT process. Therefore, lncRNAs altering E-cad expression are involved in carcinogenesis. We constructed a series of noncoding RNA expression vectors and verified their overexpression effects in HEK-293T cells (Figure 1A–E). Then, we screened noncoding RNAs that potentially regulated the E-cad gene promoter by dual-luciferase reporter assay, including HOTAIR, LOC105375819, BX647792, and PANDAR. The human E-cad promoter reporter plasmid and a series of lncRNAs or circular RNAs were cotransfected into HEK-293T cells. We found that the overexpression of ciR-hsa_circ_0001073 (1.148 ± 0.014) and LOC105375819 (1.205 ± 0.019) significantly increased the luciferase activity, whereas overexpression of PANDAR (0.897 ± 0.041) suppresses the luciferase activity (Figure 1F). This finding suggests that ciR-hsa_circ_0001073, LOC105375819, and PANDAR may regulate E-cad expression in human cells.

Figure 1

Screening of lncRNAs regulating the activity of the E-cad gene promoter. (A–E) The overexpression efficiency of a series of noncoding RNAs were detected by qRT-PCR. (F, G) Indicate lncRNA expression vectors, reporter plasmid containing human (F) or mouse (G) E-cad promoter and the internal control plasmid pRL-TK were cotransfected into HEK-293T cells. We measured luciferase activities 48 h after transfection. The ratio of firefly-to-Renilla luciferase activity was calculated and results were normalized to the corresponding negative control. Data are represented as the mean ± SD of triplicate assays. E-cad, E-cadherin; lncRNAs, long noncoding RNAs; SD, standard deviation.

To explore which regulation mechanism is evolutionarily conservative, the mouse E-cad promoter reporter vector and a series of lncRNAs or circular RNAs were cotransfected into HEK-293T cells, respectively. This was done to assess whether the abilities of ciR-hsa_circ_0001073, LOC105375819, and PANDAR able to regulate E-cad transcription were evolutionarily conserved. LOC105375819 (1.219 ± 0.086) remarkably increased luciferase activity, which was reduced by PANDAR (0.692 ± 0.071) and BX647792 (0.566 ± 0.032) (Figure 1G). These findings indicated that LOC105375819 and PANDAR regulated the promoter activity of the E-cad gene with evolutionary conservatism.

PANDAR downregulates E-cad, but upregulates N-cad

Because PANDAR modulated E-cad promoter activity, we hypothesized that it might contribute to modulating the EMT process. First, PANDAR was overexpressed in MCF-7 cells by using lentivirus, and then qRT-PCR was used to detect the efficiency of overexpression of PANDAR (Figure 2A). Further, western blotting was performed to determine the expression profile of EMT-related proteins, including E-cad, and N-cad protein. As depicted in Figure 2B, an increased PANDAR expression led to elevated N-cad levels. However, it reduced E-cad levels compared with the control group, suggesting that it may potentially control EMT in breast cancer.

Figure 2

PANDAR suppress the expression of E-cad while simultaneously upregulating the expression of N-cad at the protein level. To obtain stable cell lines expressing PANDAR and corresponding control, lentiviruses were used to infect MCF-7 cells. (A) qRT-PCR were used to determine the overexpression efficiency of PANAR in MCF-7 cells. Data are represented as the mean ± SD of triplicate assays. (B) Western blotting was performed to determine the expression profile of EMT biomarkers, including E-cad and N-cad protein. Tubulin served as an internal control. E-cad, E-cadherin; EMT, epithelial-mesenchymal transition; MCF-7, Michigan cancer foundation-7; N-cad, N-cadherin; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.

PANDAR enhances MCF-7 cell proliferation

MCF-7 cell expressing PANDAR or corresponding control was seeded into 96-well plates with the same density, followed by the photomicrographs and CCK8 assay to quantitate cell proliferation at indicated times (Figure 3A, B). The overexpression of PANDAR significantly increased MCF-7 cell proliferation at day 3 post-plating (1.000 ± 0.120 vs 1.412 ± 0.105). This significant increase in MCF-7 cell proliferation suggests that PANDAR is an oncogene regulating breast cancer proliferation.

Figure 3

MCF-7 cell proliferation is significantly increased after PANDAR overexpression. (A) Different treatments of MCF-7 cells were seeded at the same density and photographed under a microscope 3 days later. (B) PANDAR overexpression in MCF-7 cells through a lentiviral vector. PANDAR overexpressing cells and control cells were plated at the same density followed by a CCK-8 assay to quantify cell proliferation. Three days after plating, the MCF-7 cells overexpressing PANDAR had proliferated significantly. Each experiment was repeated 4 times. Data are represented as the mean ± SD. CCK-8, cell counting kit-8; MCF-7, Michigan cancer foundation-7; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.

Discussion

Several previously constructed recombinant lncRNA plasmids were screened by dual-luciferase reporter assay. In the present research, PANDAR, LOC105375819, HOTAIR, ciR-has_circ_0001073, BX647792, and PANDAR were compared with the control group. The results revealed that LOC105375819 significantly promoted the transcription of the E-cad promoter, whereas PANDAR significantly inhibited the transcription of the E-cad promoter. Indeed, it was previously reported that high expression of PANDAR in colon cancer predicts poor patient prognosis and promotes metastasis through EMT [12]. The regulatory mechanism of lncRNA on the promoter is more complicated, and most of the regulatory effects belong to fine-tuning. Some lncRNAs can regulate gene expression by adsorbing endogenous miRNAs. Some lncRNAs can be used as scaffolds to bind to promoters to recruit other transcription factors. The molecular mechanism of PANDAR regulating E-cad remains unclear. The weak regulatory effect of PANDAR on E-cad promoters may imply an indirect regulation.

Primer sequences.

Upstream primer sequence (5′–3′) Downstream primer sequence (5′–3′)
HOTAIR CAAGCTTCGAATTACGAATTCGACTCGCCTGTGCTCTGGAGCTTG TTATCTAGAGTCGCGGGATCGGAAAATGCATCCAGATATTAATAT
TCONS00068220 CAAGCTTCGAATTACGAATTCCCGACTTTCACTTATCAGACCTTG TTATCTAGAGTCGCGGGATCGGGTGAGCAGTTTTTATTAACCTGT
PANDAR CAAGCTTCGAATTACGAATTCTTTCAGGAATGCCGCAGATGTACA TTATCTAGAGTCGCGGGATCGCAGTGGCTCACGCCTGTAATCTCA

Western blotting was performed to determine the expression profile of EMT-related proteins, including E-cad, and N-cad. The results show that PANDAR inhibited the expression of the E-cad. The core promoter region of the E-cad gene derived from humans differs considerably from that found in mice. However, the human gene for PANDAR also regulated the E-cad promoter of mice, which further implies that the regulatory effect of PANDAR on the E-cad promoter may depend on a small number of nucleic acids or a spatial structure of the promoter that is evolutionarily conserved.

By contrast, PANDAR was overexpressed in MCF-7 cells through lentiviral infection, followed by the CCK8 assay to quantify cell proliferation. The CCK-8 assay also established that PANDAR upregulation markedly enhanced proliferation of MCF-7 cells. A previous study revealed that PANDAR is activated in a p53-dependent fashion and interacts with nuclear transcription factor YA (NF-YA) to suppress proapoptotic genes, thereby inhibiting cell apoptosis [19]. Additionally, PANDAR plays an oncogenic role in bladder cancer by inducing cell proliferation and suppressing proapoptotic pathways [20]. PANDAR was demonstrated to modulate G1/S arrest in breast cancer cells via p16INK4A downregulation [11]. These data are consistent with our results showing that PANDAR promotes breast cancer cell proliferation.

Conclusion

The lncRNA PANDAR regulates the inhibition of the promoter activity of the E-cad gene and promotes breast cancer cell proliferation. Although further functional experiments are necessary, the current findings provide new insights into the molecular mechanisms underpinning PANDAR's effect on the EMT process in breast cancer.

eISSN:
1875-855X
Lingua:
Inglese
Frequenza di pubblicazione:
6 volte all'anno
Argomenti della rivista:
Medicine, Assistive Professions, Nursing, Basic Medical Science, other, Clinical Medicine