Accesso libero

Culturable Endophytes Diversity Isolated from Paeonia ostii and the Genetic Basis for Their Bioactivity

INFORMAZIONI SU QUESTO ARTICOLO

Cita

Fig. 1.

Phylogenetic relationship of isolated bacterial endophytes and reference bacteria based on 16S rRNA gene sequences. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The GenBank accession numbers of 16S rRNA sequences are given in the parentheses. The scale bar represents 0.02 nucleotide changes.
Phylogenetic relationship of isolated bacterial endophytes and reference bacteria based on 16S rRNA gene sequences. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The GenBank accession numbers of 16S rRNA sequences are given in the parentheses. The scale bar represents 0.02 nucleotide changes.

Fig. 2.

Phylogenetic relationship of isolated fungal endophytes and reference fungal based on ITS gene sequences. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The GenBank accession numbers of ITS sequences are given in the parentheses. The scale bar represents 0.05 nucleotide changes.
Phylogenetic relationship of isolated fungal endophytes and reference fungal based on ITS gene sequences. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The GenBank accession numbers of ITS sequences are given in the parentheses. The scale bar represents 0.05 nucleotide changes.

Fig. 3.

The phylogenetic relationship of endophytic bacteria based on PKSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.1 amino acid changes.
The phylogenetic relationship of endophytic bacteria based on PKSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.1 amino acid changes.

Fig. 4.

The phylogenetic relationship of endophytic bacteria based on NRPSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.10 amino acid changes.
The phylogenetic relationship of endophytic bacteria based on NRPSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.10 amino acid changes.

Fig. 5.

The phylogenetic relationship of endophytic fungi based on type I PKSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.10 amino acid changes.
The phylogenetic relationship of endophytic fungi based on type I PKSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.10 amino acid changes.

Fig. 6.

The phylogenetic relationship of endophytic fungi based on NRPSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.20 amino acid changes.
The phylogenetic relationship of endophytic fungi based on NRPSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.20 amino acid changes.

PKS and NRPS genes in endophytic bacteria isolated from Paeonia ostii.

GeneNo. of isolatesAmino acid residuesAccession numberTop BLASTP match (GenBank accession No.)Identity (%)Predicted binding pocket (amino acid substrate)
PKSMd1-2226MF589505polyketide synthase, Nostoc sp. (AGJ72843)144/226(64%)Not done
PKSMd1-4227MF589506polyketide synthase, Bacillus sp. (ACG70843)226/227(99%)Not done
PKSMd1-6227MF589507type I ketosynthase, Bacillus sp. (AIO09656)220/224(98%)Not done
PKSMd1-9224MF589508type I ketosynthase, Bacillus sp. (AIO09656)220/222(99%)Not done
PKSMd1-21223MF589509type I ketosynthase, Bacillus sp. (AIO09652)222/222(100%)Not done
PKSMd1-24227MF589510polyketide synthase, Bacillus sp. (ACG70842)224/227(99%)Not done
PKSMd1-37227MF589511polyketide synthase, Bacillus sp. (ACG70841)226/227(99%)Not done
PKSMd1-41227MF589512polyketide synthase, Bacillus sp. (ACG70841)226/227(99%)Not done
PKSMd1-43226MF589513type I ketosynthase, Bacillus sp. (AIO09656)219/224(98%))Not done
PKSMd1-44224MF589514type I ketosynthase, Bacillus sp. (AIO09656)218/222(98%)Not done
PKSMd1-45229MF589515polyketide synthase, Bacillus sp. (ACG70842)226/229(99%))Not done
PKSMd1-50227MF589516polyketide synthase, Bacillus sp. (ACG70843)227/227(100%)Not done
PKSMd1-51223MF589517type I ketosynthase, Bacillus sp. (AIO09656)221/222(99%)Not done
NRPSMd1-2232MF589518non-ribosomal peptide synthetase, Streptomyces hiroshimensis(BAH68742)158/217(73%)DFECLSVVT-(Val)
NRPSMd1-18232MF589519non-ribosomal peptide synthetase, Streptomyces hiroshimensis (BAH68742)158/217(73%)DFECLSVVT-(Val)
NRPSMd1-24252MF589520nonribosomal peptide synthase, Bacillus sp. (KIA75709)249/252(99%)DAKDLGVVD-(Glu)
NRPSMd1-47233MF589521non-ribosomal peptide synthetase, Pseudomonas sp. (WP_085703687)225/233(97%)DAWVFGVVI-(Glu)
NRPSMd1-50245MF589522non-ribosomal peptide synthetase, Bacillus velezensis (WP_069007535)243/245(99%)DFWNIGMVH-(Thr)

PKS and NRPS genes in endophytic fungi isolated from Paeonia ostii.

GeneNo. of isolatesAmino acid residuesAccession numberTop BLASTP match (GenBank accession No.)Identity (%)Predicted binding pocket (amino acid substrate)
PKSMdf-4250MF680559related to fusarin C cluster-polyketide synthase/NRPS, Rhynchosporium agropyri (CZS94917)222/250(89%)Not done
PKSMdf-15238MF680560ketoacyl-synt-domain-containing protein, Coniochaeta ligniaria (OIW26903)201/240(84%)Not done
PKSMdf-17211MF680561beta-ketoacyl synthase domain-containing protein, Metarhizium album (KHO00577)201/240(84%)Not done
PKSMdf-26231MF680562PKS protein, Trichoderma parareesei (OTA00034)175/231(76%)Not done
PKSMdf-41234MF680563polyketide synthase PksF, Alternaria alternata (XP_018382155)233/234(90%)Not done
PKSMdf-43238MF680564ketoacyl-synt-domain-containing protein, Coniochaeta ligniaria (OIW26903)227/234(97%)Not done
PKSMdf-44234MF680565polyketide synthase PksF, Alternaria alternata (XP_018382155)131/217(60%)Not done
PKSMdf-47250MF680566related to fusarin C cluster-polyketide synthase/NRPS, Rhynchosporium agropyri (CZS94917)233/234(99%)Not done
PKSMdf-49234MF680567polyketide synthase PksF, Alternaria alternata (XP_018382155)233/234(99%)Not done
PKSMdf-51234MF680568polyketide synthase PksF, Alternaria alternata (AFN68297)233/234(99%)Not done
NRPSMdf-2244MF680550acetyl-CoA synthetase-like protein, Stagonospora sp. (OAK98265)218/244(89%)No prediction
NRPSMdf-6234MF680551nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793)195/235(83%)DIGFVGGIF-(Ile)
NRPSMdf-8231MF680552nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793)208/231(90%)DVTLVGCVV-(Cys)
NRPSMdf-9222MF680553nonribosomal peptide synthetase, Cenococcum geophilum (OCK98900)195/222(88%)DVAFIGSIH-(Phe)
NRPSMdf-18228MF680554nonribosomal peptide synthetase, Cenococcum geophilum (OCK98900)198/228(87%)DVAFIGSIH-(Phe)
NRPSMdf-20246MF680555acetyl-CoA synthetase-like protein, Stagonospora sp. (OAK98265)223/246(91%)No prediction
NRPSMdf-22238MF680556nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793)220/237(93%)DAMLVGAVI-(Gln)
NRPSMdf-41240MF680557nonribosomal peptide synthase, Alternaria alternata (XP_018382376)201/240(84%)DAILVGAVV-(Gln)
NRPSMdf-50238MF680558nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793)217/237(92%)DAMLVGAVI-(Gln)

PCR primers for identification and screening the biosynthetic genes of endophytic isolates.

Primer namePrimer Sequence (5’-3’)Target geneProduct size (bp)References
24FAGAGTTTGATC(A/C)TGGCTCAG16S rDNA1400–1500Heuer et al. 1997
1492RTACGG(C/T)TACCTTGTTACGACTT
ITS1TCCGTAGGTGAACCTGCGGITS500White et al. 1990
ITS4TCCTCCGCTTATTGATATGC
KSαFTSGCSTGCTTGGAYGCSATCBacterial PKS600–700Metsä-Ketalä et al. 1999
KSαRTGGAANCCGCCGAABCCGCT
A3FGCSTACSYSATSTACACSTCSGGBacterial NRPS700Ayuso-Sacido and Genilloud 2005
A7RSASGTCVCCSGTSGCG TAS
KAF1GARKSICAYGGIACIGGIACFungal PKS700–800Amnuaykanjanasin et al. 2005
KAR1CCAYTGIGCICCRTGICCIGARAA
AUG003CCGGCACCACCGGNAARCCHAAFungal NRPS600–700Slightom et al. 2009
AUG007CCGGACCATGTCGCCNGTBYKRTA

The distribution of endophytic bacteria and fungi within Paeonia ostii.

GeneraNo. of isolatesRelative abundance (%)
Endophytic bacteria
StreptomycesMd1-1, Md1-2, Md1-3, Md1-187.1
PromicromonosporaceaeMd1-201.8
MicrobacteriumMd1-5, Md1-293.6
CitricoccusMd1-481.8
BacillusMd1-4, Md1-6, Md1-8, Md1-9, Md1-10, Md1-11, Md1-12, Md1-13, Md1-15, Md1-16, Md1-17, Md1-19, Md1-21, Md1-22, Md1-24, Md1-25, Md1-26, Md1-31, Md1-33, Md1-35, Md1-36, Md1-39, Md1-37, Md1-41, Md1-42, Md1-43, Md1-44, Md1-45, Md1-46, Md1-50, Md1-5155.4
PsychrobacillusMd1-271.8
LysinibacillusMd1-14, Md1-303.6
PlanococcusMd1-491.8
XanthomonasMd1-23, Md1-283.6
PseudomonasMd1-341.8
SerratiaMd1-32, Md1-473.6
EnterobacterMd1-38, Md1-40, Md1-52, Md1-53, Md1-568.9
LelliottiaMd1-7, Md1-54, Md1-555.4
Endophytic fungi
CylindrocarponMdf-3, Mdf-10, Mdf-13, Mdf-15, Mdf-36, Mdf-38, Mdf-43, Mdf-4715.7
FusariumMdf-5, Mdf-6, Mdf-7, Mdf-8, Mdf-11, Mdf-18, Mdf-22, Mdf-23, Mdf-25, Mdf-2819.6
unclassified NectriaceaeMdf-262.0
ThelonectriaMdf-1, Mdf-174.0
CephalosporiumMdf-4, Mdf-484.0
LeptosphaeriaMdf-2, Mdf-9, Mdf-12, Mdf-16, Mdf-20, Mdf-29, Mdf-33, Mdf-34, Mdf-37, Mdf-40, Mdf-4621.6
AlternariaMdf-27, Mdf-30, Mdf-31, Mdf-32, Mdf-39, Mdf-41, Mdf-42, Mdf-44, Mdf-45, Mdf-49, Mdf-50, Mdf-5123.5
AcrocalymmaMdf-352.0
CladosporiumMdf-142.0
MacrophominaMdf-192.0
PhomopsisMdf-242.0
MucorMdf-212.0
eISSN:
2544-4646
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Life Sciences, Microbiology and Virology