Bacterial cells may produce several types of substances that inhibit the growth of other microorganisms. These antimicrobial agents belong to different classes of molecules, ranging from the simple compounds, like hydrogen peroxide or lactic acid to more complicated: antibiotics, peptides, exotoxins or lytic enzymes (Brito
The modes of action of AMPs, including most of the bacteriocins, involve interactions with the bacterial cell membrane, and forming complexes with lipid II – a highly conserved precursor of the bacterial cell wall (Malanovic and Lohner, 2016). Cell membrane permeabilization leads to efflux of important intracellular molecules such as mono- and divalent ions (K+, Na+, Ca2+ and Mg2+) and ATP (Di Meo
Due to high selectivity and activity against a substantial array of pathogenic microorganisms, AMP’s are a promising alternative to conventional antibacterial antibiotics (Kosikowska and Lesner, 2016; Ołdak and Zielińska, 2017). Compared to conventional antibiotic therapy, killing of microorganisms by peptides is more rapid and they can ‘attack’ multiple molecular targets related to membrane and cell wall, which highly prevents development of resistant strains. However, the results of recent years revealed that many important Gram-positive as well as Gram-negative bacteria, including dangerous human and animal pathogens, have developed mechanisms of modification of most important molecular targets of AMPs, namely cell membrane and lipid II. As a consequence these strains are highly resistant to AMPs’ activity (Andersson
In the present study, a collection of
The indicator strains used for preliminary selections of staphylococci producing antibacterial agents.
Strain | Source of the strain | Resistance |
---|---|---|
1 | Bovine mastitis | ND |
2 | Bovine mastitis | ND |
3 | Human skin wound (Koszalin) | Susceptible |
4 | Bovine mastitis | P, AMP, AML, S, AMC* |
5 | Bovine mastitis | N, MY, S, E, DA* |
6 | Bovine mastitis | P+DA+E+MY+S+N/OX* |
7 | Reference strain | ND |
– Resistance according to
Antibacterial activity of the after-culture liquid medium was measured by the agar-well diffusion method (Schillinger and Lücke, 1989). The strains found as producers of antimicrobial agents on TSA agar plates (n = 6) were grown in TSB for 24 hours at 37°C. The obtained cell suspensions were centrifuged (14 000 rpm, 10 min, room temperature) to collect the bacterial cells. The collected and filter sterilized (0.22 μm) supernatants (300 μl) were aliquoted into wells (diameter 7 mm) in solid TSA medium (TSB medium supplemented with 1.5% agar). The plates were dried in a laminar flow cabinet, and when the supernatant evaporated completely from the wells, the plates were overlaid with a soft agar layer inoculated with the cells of indicator strains to a final concentration of 0.01% (vol/vol). After incubation (24 h, 37°C), the diameters of clear zones were measured.
rP1 5’ CCCGGGATCCAAGCTTAGAGTTTGATCCTGGCTCAG 3’ fD2 5’ CCGAATTCGTCGACAACACGGCTACCTTGTTACGACTT 3’
following the method described by the group of Weisburg (1991). Sequencing of the amplified product was carried out by Macrogen (The Netherlands). The analysis of sequence was performed with using MEGA 6.1 (Molecular Evolutionary Genetics Analysis) software.
Screening of the 206 bacterial isolates resulted in the identification of six strains producing antistaphylococcal agents. Three producing strains were
Based on the sequence of the gene coding for 16S rRNA, the producing strain was identified as
Growth inhibition zone around the colony of producer strain M2B; an indicator strain –
Formation of “half moon zone” near the colony of producer strain M2B in the presence of proteolytic enzyme; an indicator strain –
Antimicrobial activity of the after-culture liquid media after growth of the producer strain.
The antimicrobial spectrum of the putative antimicrobial peptide produced by
Activity of newly identified agent against strains from the Departments’ collection.
No. of strain | Code number of the sensitive strain | Growth inhibition zone [mm] |
---|---|---|
1 | 7 ( | 12 |
2 | 11 ( | 20 |
3 | 28 ( | 15 |
4 | 52 ( | 22 |
5 | 68 ( | 25 |
6 | 77 ( | 18 |
7 | 92 ( | 17 |
8 | 99 ( | 25 |
9 | 115 ( | 15 |
10 | 83A ( | 15 |
11 | 8J ( | 15 |
12 | 30C1 ( | 15 |
13 | 247 ( | 15 |
14 | 15 | |
15 | 15 |
Conditions for the effective production of the putative bacteriocin by
The maximum level of AMP production by
The tests of thermostability revealed that the putative antimicrobial peptide did not lose its activity after 15 minutes of heating at 90°C. After 30 min of incubation in 90°C peptide lost its activity (inhibition zone was significantly smaller).
Studies on the antimicrobial substances produced by staphylococci, have not been very extensive so far. However, there are a few peptides exhibiting antistaphylococcal activity produced by bacteria that belong to this genus, including both CNS – coagulase negative and CPS – coagulase positive staphylococci. The most promising examples of AMPs produced by CNS are the following bacteriocins: Pep5, epicidin 280, epilancin K7, epidermin, nukacin ISK-1, simulancin 3299, and the most extensively characterized bacteriocins produced by CPS are: staphylococcin C55, aureocin A70, aureocin A53 (Nascimento
Our studies, results of which are presented in this work, are probably one of the very few examples of an extensive screening aimed at the identification of antimicrobial peptides produced by staphylococci isolated from humans (skin and soft tissue infections n = 48) or animals (strains isolated from bovine with mastitis n = 158). From the set of 206 strains, we identified six strains producing any antimicrobials (2.9%), of which, one was confirmed to be a putative peptide or protein with antimicrobial activity, efficiently produced in a liquid medium. Two out of three antimicrobial – producing strains identified in these studies did not produce the antimicrobial agents at the detectable level when grown in liquid media. Similar problems were recently observed by Braem and coworkers (2014), who identified
The molecular structure of the putative AMP produced by
The produced peptide exhibits also strong activity against other important foodborne pathogenic bacteria
The recent studies carried out by Hewelt-Belka and coworkers (2016) revealed some important differences in the lipid composition of
In our studies, the prevalence of isolation of strains producing AMPs was found to be at a relatively low level – below 2% (three out of 206 isolates), and only one strain (prevalence below 0.5%) produced a peptide that is worthy of further studies. However, we do not have any doubts that staphylococci represents an interesting and promising source of uncharacterized antimicrobial peptides, which could be used for treatment or prophylaxis of infections caused by other bacteria that belong to the