First report of Bitylenchus ventrosignatus (Tobar Jiménez, 1969) Siddiqi, 1986 associated with wild grass in Botswana

Rhizosphere soil samples were collected from the natural veld. Specimens were collected in the North-West District of Botswana (S 20° 8’ 24.882”, E 21° 12’ 45.475”) from the rhizosphere of wild grass. Nematode extraction was achieved using the Baermann (1917) funnel technique. Extracted individuals were fixed with a hot 4% formaldehyde solution (except those specimens used for molecular analyses) and transferred to anhydrous glycerine utilizing the method of De Grisse (1969) and mounted on permanent glass slides. The classification provided by Handoo et al. (2014) was used for the taxonomic study of Bitylenchus.

Measurements were taken of specimens mounted on permanent slides, and De Man’s (1880) indices were calculated. Drawings were made using a drawing tube (camera lucida) attached to a Leitz Laborlux S microscope (Leitz, Wetzlar, Germany). Pictures were taken with a Nikon Eclipse 80i light microscope provided with differential interference contrast optics (DIC) and a Nikon Digital Sight DS-U1 camera (Nikon, Tokyo, Japan). Micrographs were edited using Adobe® Photoshop® CS.

The terminology used for the morphology of stoma and spicules-gubernaculum follows the proposals by Baldwin et al. (2004) and Abolafia and Peña-Santiago (2017), respectively.

DNA extraction was done using the Chelex method (Straube and Juen, 2013). Five specimens of each species were hand-picked with a fine tip needle and transferred to a 1.5 mL Eppendorf tube containing 20 μL double distilled water. The nematodes in the tube were crushed with the tip of a fine needle and vortexed. Thirty microliters of 5% Chelex® 50 and 2 µL of proteinase K were added to each of the microcentrifuge tubes that contained the crushed nematodes and mixed. These separate microcentrifuge tubes with the nematode lysate were incubated at 56°C for 2 h and then incubated at 95°C for 10 min to deactivate the proteinase K and finally spin for 2 min at 16,000 rpm (Shokoohi et al., 2020). The supernatant was then extracted from each of the tubes and stored at –20°C. Following this step, the forward and reverse primers, SSU F04 (5’–GCTTGTCTCAAAGATTAAGCC–3’) and SSU R26 (5’–CATTCTTGGCAAATGCTTTCG–3’) (Blaxter et al., 1998) for 18 S rDNA and D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’), D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (De Ley et al., 1999) for 28 S rDNA, were used in the PCR reactions for partial amplification of the 18 S rDNA, and 28 S rDNA regions. PCR was conducted with 8 μL of the DNA template, 12.5 μl of 2X PCR Master Mix Red (New England Biolabs; NEB), 1μL of each primer (10 pmol μL–1), and ddH2O for a final volume of 30 μL. The amplification was processed using an Eppendorf master cycler gradient (Eppendorf, Hamburg, Germany), with the following program: initial denaturation for 3 min at 94°C, 37 cycles of denaturation for 45 s at 94°C; 54°C; and 56°C annealing temperatures for 18 S rDNA and 28 S rDNA, respectively; extension for 45 s to 1 min at 72°C, and finally an extension step of 6 min at 72°C followed by a temperature on hold at 4°C. After DNA amplification, 4 µL of product from each tube was loaded on a 1% agarose gel in TBE buffer (40 mM Tris, 40 mM boric acid, and 1 mM EDTA) for evaluation of the DNA bands. The bands were stained with ethidium bromide and visualized and photographed on a UV transilluminator. The amplicons of each gene were stored at –20°C. Finally, the PCR products were purified for sequencing by Inqaba Biotech (South Africa). Available sequences for other Bitylenchus spp. were obtained from NCBI GenBank for comparison. Also, as outgroups, Coslenchus costatus (De Man, 1921) Siddiqi, 1978 (KX156285; DQ328719) based on Handoo et al. (2014) were used as the outgroup for the 18 S and 28 S rDNA analyses, respectively. The ribosomal DNA sequences were analyzed and edited with BioEdit (Hall, 1999) and or aligned using CLUSTAL W (Thompson et al., 1994). The length of the alignments was 1,772 and 820 bps for 18 and 28 S rDNA, respectively. Phylogenetic trees were generated using the Bayesian inference method as implemented in the program Mr. Bayes 3.1.2 (Ronquist and Huelsenbeck, 2003). The GTR+I+G model was selected using jModeltest 2.1.10 (Guindon and Gascuel, 2003; Darriba et al., 2012). Then, the chosen model was initiated with a random starting tree and run with the Markov chain Monte Carlo (MCMC) for 106 generations. The trees visualized using TreeView ver. 1 (Page, 2002). The original partial 18 S rDNA and 28 S (D2-D3 expansion) sequences of B. ventrosignatus were deposited in GenBank under the accession numbers MW255611 (18 S rDNA) and MW255612–MW255613 (28 S rDNA), respectively.

(Figs. 1 and 2; Table 1).

Figure 1:

Figure 2:

Female (n = 5): Body almost open C-shaped after heat relaxation, no longitudinal striae or ridges outside lateral fields. Body annuli distinct but fine, 0.8–1.2 μm wide around mid-body. Lateral fields originating at the level of the conus of the stylet and extending up to hyaline region of tail to tail terminus, with four incisures, 13–26% of the corresponding body diameter. Lip region high, spherical, offset to body contour, 3.8 ± 0.3 (3–4) μm height, 7.4 ± 0.8 (6–8) μm diameter; with four annuli. Stoma comprises cheilostom (=conus) 52–54% of the stoma length, gymnostom (=almost part of the shaft) 38–40% of the stoma length, and prostegostom (=posterior part of the shaft and knobs) 8–9% of the stoma length. Stylet moderately strong, conus slightly longer than shafte; knobs laterally to posteriorly directed. Dorsal gland orifice about 1.4–2.5 μm long behind stylet base. Median pharyngeal bulb rounded; basal bulb pyriform. Cardia well developed. Hemizonid usually just two to three annuli anterior to excretory pore, 1.0–1.5 annuli wide. Vulva a transverse slit slightly posterior to the middle of the body, vagina with 9.3 ± 1.6 (7.3–11.4) µm length. Epiptygma absent. Cuticle posterior to vulva with undulation. Reproductive system amphidelphic, didelphic; anterior (one measurement, 122 µm) and posterior (one measurement, 126 µm) ovaries well developed. Spermatheca rounded, filled with rounded spermatozoa. Tail subcylindrical, tail terminus rounded or conical and smooth. Phasmids located slightly anterior to middle of the tail, 38–42% of tail length. Post-anal intestinal sac present.

Male (n=5): Body J-shaped after relaxation. Abundant, similar to the females morphologically, except for the reproductive system. Testis one, outstretched anteriorly. Spicules tylenchoid, paired and symmetrical, 8–10 times longer than wide: slightly elongate and ventrally curved, rounded manubrium, short and straight calamus, and ventrad curved lamina with an acute tip, bursa large and conspicuous, extending to tail tip, 59–76 µm long. Gubernaculum are well developed, curved, about 34–41% of the spicule length. Tail terminus conoid-pointed.

Phylogenetic analysis The Bayesian inference tree of 18 S rDNA of Bitylenchus species (Fig. 3) placed the Botswanan B. ventrosignatus close to Spanish B. ventrosignatus (acc. nr: KJ461617) with 0.61 posterior probability. In contrast, the Bayesian tree of 28 S rDNA (Fig. 4), placed Botswanan B. ventrosignatus close to the Spanish (KJ461567), Iranian (MW481638; MW481639) and Tanzanian (MT089939; MT089940) populations of B. ventrosignatus with 1.00 posterior probability.

Figure 3:

Figure 4: