Cultivation of Caenorhabditis elegans on new cheap monoxenic media without peptone
Pubblicato online: 01 gen 2021
Pagine: 1 - 23
DOI: https://doi.org/10.21307/jofnem-2021-036
Parole chiave
© 2021 Authors, published by Sciendo.
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
The nematode
Recently, there has been increased interest in biodiversity sampling of free-living nematodes, especially those in the
The majority of nematode sampling effort has been done by researchers based or trained in Europe, Japan, or the USA. However, logistically local African, South American, and Southeast Asian scientists are better situated for sampling. Unfortunately, many scientists in these regions are often constrained by limited research resources.
Even the material costs, which can vary from country to country, could accumulate prohibitively for NGM agar plates, a defined medium composed of some salts, cholesterol, peptone, and agar (Brenner, 1974; Stiernagle, 2006). The salts (trace minerals) and cholesterol are directly essential for
Inspired an earlier publication that used horse liver extract in axenic media (Dougherty, 1953) for rearing nematodes, we sought to find cheaper, crude extract replacements for cholesterol, peptone, and minerals. In this study, we tested 25 alternative media permutations for rearing
NaCl (Bio Basic Canada Inc., 7647-14-5), peptone (TM MEDIA, 1506), agar (TM MEDIA, 242 M), nutrient agar (TM MEDIA, TM341), plant cooking oil (Tuong An Company, Ngon), yeast extract (Bio Basic Canada Inc., G0961), cholesterol powder (Across Organics, 110190250), CaCl2 (Fisher, 10043-52-4), MgSO4 (Fisher, 10034-99-8), KH2PO4 (Merck, 7778-77-0), and K2HPO4 (Fisher, 7758-11-4). All chemicals were stored at room temperature (25–30°C).
1 mL of 1 M CaCl2, 1 mL of 1 M MgSO4, and 25 mL of 1 M KPO4 (pH 5.57) were mixed together in 1 L of double distilled water and then autoclaved at 118°C for 20 min.
Straw mushrooms (
For
An approximately 1,000 g soil sample was collected underneath grass from a field in Cao Phong District, Hoa Binh Province, Vietnam (20o44’18.6” N, 105o19’003” E). A grassy site was chosen because such a site presumably contained more minerals, and perhaps other nutrients, than sites without vegetation. Digging of soil started at a depth of ~10 cm covering a ~40 cm radius and continued downward for another ~5 cm. A portion of this soil (125 g) was mixed into 470 mL of distilled water, distributed into ten 50-ml tubes, and then centrifuged with an Eppendorf Centrifuge 5810 R using a 50-ml rotor at 2,000 rpm for 5 min. The upper solution was decanted into a new flask and the sediment pellet was discarded.
One whole egg was manually whipped together with a stirring rod for about 5 to 10 min until the egg white and yolk were completely mixed based on appearance. This mixture was frozen as the stock egg mixture.
5 g of yeast extract, 1 g of nutrient agar, and 10 g of NaCl were mixed together in 1 L of distilled water, autoclaved at 118°C for 20 min, and then poured into Petri plates (Sambrook and Russell, 2001).
17 g of agar and 3 g of NaCl were mixed together in 1 L of distilled water, autoclaved at 118°C for 20 min, and then poured into Petri plates.
We made 25 different media types (Nematode Cheap Media; NcM1 to NcM25) using the media components listed in Table 1. Except for media with “unautoclaved” mushroom solution, we mixed all components together and autoclaved them at 118°C for 20 min in 250 mL volumes. For media with “unautoclaved” mushroom, we first autoclaved 245 mL of all the components minus the mushroom solution and then added 2.5 mL of each of the two mushroom solutions (i.e., 5 mL total) to the post-autoclaved media while it was still warm. NGM was prepared following the standard protocol (Stiernagle, 2006). All media were poured into glass Petri plates, allowed to solidify, and then seeded with an overnight culture of
Media components of NcMs and NGM.
Source of cholesterola | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Plant cooking oil | Chicken egg | Pig fat | Mushroom | Soil | |||||||||||||||||||||
Component (Amount/ L) | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM |
|
Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | |||||||||||||||||||
|
Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | |||||||||||||||||||
|
Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | |||||||||||||||||||
|
Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | |||||||||||||
|
Ѵ | Ѵ | Ѵ | ||||||||||||||||||||||
|
Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | |||||||||||||||||
|
Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | ||||||||||||||||
|
Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ |
|
Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | Ѵ | ||
Media type | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM | NcM |
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 |
Notes: aPure cholesterol was replaced with chicken egg, pig fat and/or mushroom extract. Mushroom may have nutrients in addition to cholesterol. bThe soil solution was intended as a replacement for the pure minerals (salt mixture) in NGM, however it may have included additional nutrients.
Prior to the brood assays, L1 stage worms growing on NGM were transferred onto the test media to allow acclimation for one generation. From their progeny, a batch of 2 to 10 (mode = 7) synchronized L2 hermaphrodites (P0) were placed onto each bacterium-seeded test media plate. The P0s were transferred to a new plate every day until they stopped laying eggs. Eggs on each plate were allowed to hatch and develop until the L2 to L4 stages. Then, to facilitate counting, the F1 offspring were killed with mild heat, which preserves the worm’s shape, by passing the plates over the flame of an alcohol lamp as follows. The plates were held barehanded with the open agar surface facing the flame about one to two inches away; the plates were moved back and forth for up to about 10 seconds until the plates felt a little warm.
Average brood sizes were first determined per batch of P0s (total brood across all days divided by the initial number of P0s). Then, the global average was determined by averaging the per batch average brood sizes. Note, the standard errors (SE) for each data set is the SE among P0 batches and not the SE across individual P0s. In addition, a batch smooths out the variation among individuals. Thus, among the batch SE is expected to be smaller than among individual SEs. Brood size comparisons were analyzed with one-way ANOVA and then Dunnett’s post-hoc test.
Ten L1 worms (P0) that were growing on standard NGM media were transferred to a test media plate and allowed to grow and reproduce offspring. After, 10 to 50 newly hatched L1 F1s were transferred to a fresh test media plate to start the lifespan assay. These worms were transferred to a new media plate every two or three days. A worm was scored as dead if its body was still present on the agar surface of the plate and it did not move when tapped with a worm pick. A few worms that died on the edge of the plate were not counted (censored) in the lifespan data set. Lifespan was analyzed using the log-rank (Mantel-Cox) test (code: Pairwise_survdiff(Surv(Longevity, Stage code) ~ Media, p.adjust = ”bonferroni”, data = data set) to compare each NcM with NGM (Kassambara, 2020).
Worms that had been growing on one of seven “source” NcMs (NcM6, NcM8, NcM9, NcM12, NcM18, NcM20, and NcM25) were tested if they preferentially migrated to one of the same seven NcMs or NGM “destination plugs”. For these assays, all source media plates were seeded within a 15 min time window with 90 µL of an overnight
Test assay plates were plain agar plates (no nutrients and no OP50, see above) onto which one 1.7-cm diameter plug (cut using a standard test tube) from each of the eight new OP50-seeded destination plates (seven NcM destination media and NGM) was placed; plugs were evenly spaced and placed radially 1.0 cm from the center (Fig. 1). After letting the assembled test assay plate “settle” for one hour at room temperature, 30 young-adult F2 worms were placed in the center of a test plate. The worms could then freely migrate. After two hours, the locations of the worms were recorded (on each plug, in the center, or not observed [called “Lost”]). The preference tests were conducted in the winter time so room temperature was around 16–18°C. Four biological replicates per source media type were conducted for a total of 28 assays.
Figure 1:
Schematic of media preference assay. OP50-seeded plugs of the eight indicated NcMs (grey circles) are placed onto a 9 cm-diameter plain agar plate 1 h before the preference assay. At the start of the assay, 30 well-fed young adult F2 worms are placed within the center circle (CT) and then allowed to migrate. After 2 h, the locations of the worms were recorded.

To ascertain whether there would be any relationship between a particular media source and media preference levels, and a group of media destinations and media preference levels, the effects of either each media source or destination were analyzed using a generalized linear model (GLM; code: summary(glht(aov,linfct=mcp(in=”Dunnett”)))) (Hothorn et al., 2008). Dunnett’s post-hoc test was used to compare each preference percentage against one of two destinations: the source-as-destination (i.e., when both source and destination were the same, e.g., both NcM6) or NGM.
For each of the seven media used in the preference assay and NGM, 6 mL of the growth media was poured into 6-cm Petri plates and allowed to solidify. Next, 50 µL of an OP50 suspension was spread onto each plate and then the plates were incubated at 25–30°C for three days. After, the OP50 lawn on each plate was washed off by adding 1 mL of distilled water and shaking the plate on a shaking machine at 80 rpm for 15 min; this was repeated once and the two suspensions were pooled. The OD600 value was then measured on a 752B VIS spectrophotometer. Three replicates of each growth media were tested; replicates were done in parallel. To minimize environmental differences, all media were poured on the same day and all experiments were conducted in parallel.
Nematodes found in rotting vegetation were isolated following standard methods (Barriere and Felix, 2006). Sixteen rotting vegetation samples were collected during the third week of November 2020 in Cat Tien National Park in Vietnam. Approximately 20–30 g of each sample was placed on OP50-seeded NcM6, NcM8, NcM12, NcM18, and NGM plates in parallel (9-cm diameter) and incubated for 3 to 7 days at room temperature. All sixteen samples yielded nematodes on at least one of the five media plates. Only the sample for which nematodes were first observed (11o23’55.9” N, 107o20’15.3” E; on day 3) is reported in detail because, unfortunately, the nematodes from the other 15 samples were lost due to technical reasons.
For this sample, more than one type of nematode was observed on the NcM18 plates. The adult nematodes that had similar features (body size and shape of head and tail) to
The same sample used to isolate nematodes, above, was used to isolate wild bacterial strains. Approximately 17 g of rotting vegetation was put in a 15 mL tube filled with 10 mL of sterile water and then mixed by pipetting up and down. This first solution was further diluted 1,000-fold in sterile water and then 100 µL of the diluted solution was spread onto a LB-agar plate (9-cm diameter). The plate was incubated at room temperature (20–25°C for these experiments) for 2 days. Two bacterial colonies grew on the plate and each was individually picked into LB broth, cultured at room temperature for DNA isolation, and frozen in 25% (v/v) glycerol. One bacterial strain was identified based on 16 S rDNA PCR amplification using the QUGP-Fn5 (5’–ACTCCTACGGGAGGCAGCAG–3’) and QUGP-Rn2 (5–TGACGGGCGGTGTGTACAG–3’) primers (Vingataramin and Frost, 2015) followed by sequencing and nucleotide BLAST comparison to the NCBI nucleotide database. This
All statistical analyses were conducted in R Software (versions 3.63 and 4.0.4 (R Core Team, 2017)). The single step Bonferroni correction method was used to control for multiple test correction.
We reasoned that several of the reagents in NGM could potentially be replaced by cheaper, less well-defined components and still support robust
We combined these five components along with subsets of the standard NGM reagents in 25 media permutations (or Nematode Cheap Media, NcM, Table 1). We first confirmed that all 25 NcMs could support OP50 growth. Lawns were observed on the OP50-seeded plates even on the presumptively most nutrient-poor media (NcM25: soil + agar + NaCl); this was not contamination as control media plates without seeding OP50 did not exhibit any bacterial growth. Next, we conducted two assays to examine how well
The ability for
Brood sizes of
Media | Number of tested hermaphrodites | Total brood size (Mean ± SE) | Dunnett’s post-hoc |
---|---|---|---|
NGM | 39 | 254.7 ± 12.8 | Control |
NcM1 | 57 | 144.9 ± 8.8 | <0.001 |
NcM2 | 50 | 123.8 ± 8.7 | <0.001 |
NcM3 | 55 | 157.5 ± 10.6 | <0.001 |
NcM4 | 55 | 123.8 ± 14.4 | <0.001 |
NcM5 | 25 | 142.9 ± 14.8 | <0.001 |
NcM6 | 42 | 240.5 ± 18.0 | 0.0228 |
NcM7 | 17 | 171.1 ± 18.3 | <0.001 |
NcM8 | 26 | 265.8 ± 8.7 | 0.5468 |
NcM9 | 32 | 194.5 ± 9.1 | <0.001 |
NcM10 | 29 | 152.3 ± 17.3 | <0.001 |
NcM11 | 24 | 163.9 ± 12.5 | <0.001 |
NcM12 | 21 | 234.0 ± 8.8 | 0.1817 |
NcM13 | 50 | 128.9 ± 14.2 | <0.001 |
NcM14 | 47 | 183.6 ± 7.5 | <0.001 |
NcM15 | 43 | 203.6 ± 7.9 | <0.001 |
NcM16 | 40 | 198.6 ± 9.3 | <0.001 |
NcM17 | 38 | 177.2 ± 17.5 | <0.001 |
NcM18 | 44 | 251.7 ± 16.2 | 1.0 |
NcM19 | 38 | 163.2 ± 12.9 | <0.001 |
NcM20 | 35 | 48.7 ± 12.9 | <0.001 |
NcM21 | 26 | 178.9 ± 12.4 | <0.001 |
NcM22 | 35 | 183.4 ± 11.6 | <0.001 |
NcM23 | 16 | 138.4 ± 17.3 | <0.001 |
NcM24 | 39 | 178.7 ± 9.5 | <0.001 |
NcM25 | 45 | 167.0 ± 8.2 | <0.001 |
Note: Gray shading highlights the three media on which worms had brood sizes not different from NGM. Pink shading highlights NcM6 which was only slightly inferior to NGM. Worms on all the remaining NcM media yielded fewer worms than NGM control (yellow). The standard errors (SE) and error bars for each data set are the SE among P0 batches and not the SE across individual P0s.
Figure 2:
Brood sizes of

Brood sizes of
Media | Number of tested hermaphrodites | Total brood size (Mean ± SE) | Dunnett’s post hoc |
---|---|---|---|
NGM | 37 | 23.3 ± 5.0 | Control |
NcM6 | 42 | 54.8 ± 14.6 | <0.001 |
NcM12 | 37 | 48.2 ± 8.4 | <0.001 |
NcM18 | 32 | 67.2 ± 15.7 | <0.001 |
Note: Worms had bigger brood sizes on all three NcMs than NGM control (yellow). Note, the standard errors (SE) and error bars for each data set are the SE among P0 batches and not the SE across individual P0s.
Next, to examine the broader potential of NcMs for
Longevity is another indicator of the growth media quality. To evaluate the effects of the media on the lifespan of
We found that worms growing on the media with the highest brood counts (NcM6, NcM8, NcM12, and NcM18) and NcM20 had lifespans (all means ≥ 14.5 days) not significantly different from NGM (15.2 ± 0.4, mean ± 1 SE; all
Lifespan assays of
Media | Number of tested hermaphrodites | Lifespan (days) Mean ± SE | Log-rank |
---|---|---|---|
NGM | 73 | 15.2 ± 0.4 | Control |
NcM6 | 70 | 14.8 ± 0.3 | 1.0 |
NcM8 | 72 | 14.5 ± 0.4 | 1.0 |
NcM9 | 34 | 21.9 ± 0.9 | 4e−09 |
NcM12 | 66 | 15.6 ± 0.4 | 1.0 |
NcM18 | 50 | 15.1 ± 0.5 | 1.0 |
NcM20 | 63 | 16.9 ± 0.5 | 0.39 |
NcM25 | 57 | 18.8 ± 0.6 | 2.4e−05 |
Note: Gray shading highlights the media on which worms had longer lifespans than NGM control (red).
Number of surviving
Number of surviving worms | ||||||||
---|---|---|---|---|---|---|---|---|
Day | NGM | NcM6 | NcM8 | NcM9 | NcM12 | NcM18 | NcM20 | NcM25 |
1 | 73 | 70 | 72 | 34 | 66 | 50 | 63 | 57 |
2 | 73 | 70 | 72 | 34 | 66 | 50 | 63 | 57 |
3 | 73 | 70 | 72 | 34 | 66 | 50 | 63 | 57 |
4 | 73 | 70 | 72 | 34 | 66 | 50 | 63 | 57 |
5 | 72 | 69 | 72 | 34 | 66 | 49 | 63 | 57 |
6 | 72 | 69 | 72 | 34 | 65 | 49 | 63 | 57 |
7 | 70 | 69 | 70 | 34 | 64 | 48 | 62 | 55 |
8 | 70 | 69 | 70 | 34 | 64 | 48 | 61 | 54 |
9 | 70 | 68 | 70 | 34 | 62 | 46 | 59 | 52 |
10 | 67 | 68 | 63 | 32 | 61 | 46 | 59 | 52 |
11 | 63 | 68 | 55 | 31 | 60 | 45 | 58 | 51 |
12 | 58 | 62 | 48 | 30 | 57 | 42 | 56 | 51 |
13 | 52 | 55 | 41 | 30 | 54 | 39 | 52 | 51 |
14 | 46 | 42 | 36 | 30 | 49 | 33 | 51 | 50 |
15 | 33 | 23 | 32 | 30 | 37 | 17 | 47 | 49 |
16 | 21 | 12 | 18 | 30 | 26 | 13 | 36 | 39 |
17 | 12 | 5 | 14 | 28 | 15 | 9 | 28 | 38 |
18 | 11 | 4 | 8 | 28 | 11 | 6 | 21 | 33 |
19 | 10 | 3 | 7 | 28 | 7 | 5 | 14 | 30 |
20 | 6 | 2 | 3 | 27 | 3 | 4 | 10 | 28 |
21 | 5 | 1 | 3 | 21 | 0 | 2 | 7 | 17 |
22 | 2 | 0 | 1 | 16 | 1 | 2 | 9 | |
23 | 2 | 1 | 14 | 1 | 1 | 8 | ||
24 | 2 | 1 | 11 | 1 | 0 | 5 | ||
25 | 1 | 1 | 7 | 1 | 0 | |||
26 | 0 | 0 | 4 | 1 | ||||
27 | 3 | 1 | ||||||
28 | 2 | 1 | ||||||
29 | 2 | 0 | ||||||
30 | 1 | |||||||
31 | 0 | |||||||
Censored | 7 | 10 | 8 | 6 | 14 | 5 | 17 | 23 |
Figure 3:
Lifespan assays of

Lifespan of
Media | Number of tested hermaphrodites | Lifespan (days) Mean ± SE | Log-rank |
---|---|---|---|
NGM | 107 | 14.96 ± 0.42 | Control |
NcM6 | 71 | 16.35 ± 0.51 | 0.4 |
NcM12 | 76 | 15.49 ± 0.53 | 1.0 |
NcM18 | 133 | 12.3 ± 0.35 | 1.3e−05 |
Note: Gray shading highlights the media on which worms had lifespans not different from NGM control (red).
Number of surviving
Number of surviving worms | ||||
---|---|---|---|---|
Day | NGM | NcM6 | NcM12 | NcM18 |
1 | 107 | 71 | 76 | 133 |
2 | 107 | 71 | 76 | 133 |
3 | 107 | 71 | 76 | 133 |
4 | 107 | 71 | 76 | 133 |
5 | 107 | 71 | 76 | 133 |
6 | 107 | 71 | 76 | 133 |
7 | 105 | 71 | 76 | 133 |
8 | 103 | 70 | 73 | 112 |
9 | 97 | 68 | 67 | 91 |
10 | 85 | 63 | 62 | 77 |
11 | 81 | 60 | 61 | 64 |
12 | 75 | 57 | 57 | 53 |
13 | 66 | 53 | 52 | 44 |
14 | 56 | 47 | 45 | 30 |
15 | 46 | 42 | 36 | 24 |
16 | 36 | 33 | 30 | 21 |
17 | 27 | 24 | 21 | 20 |
17 | 22 | 20 | 14 | 13 |
19 | 17 | 15 | 12 | 7 |
20 | 13 | 13 | 10 | 5 |
21 | 7 | 10 | 10 | 4 |
22 | 4 | 10 | 4 | 2 |
23 | 3 | 5 | 4 | 2 |
24 | 2 | 2 | 4 | 2 |
25 | 2 | 1 | 3 | 1 |
26 | 2 | 0 | 1 | 1 |
27 | 1 | 1 | 0 | |
28 | 1 | 1 | ||
29 | 1 | 1 | ||
30 | 0 | 0 |
Next, we similarly determined the longevity of
Previous studies have shown that food amount correlated positively with brood size but negatively with lifespan (Lenaerts et al., 2008; Yu et al., 2015). We tested for a correlation between brood size and lifespan across the different NcMs and NGM for which both were assayed. Our brood size and lifespan results varied among the eight different media, and somewhat in opposite directions (rho = −0.76,
Because we had multiple media sources available, we considered the possibility that
Analysis of the data using a generalized linear model revealed that neither source nor destination media had a significant linear regression relationship with preference percentage (
Source | All | NcM6 | NcM8 | NcM9 | NcM12 | NcM18 | NcM20 | NcM25 |
---|---|---|---|---|---|---|---|---|
|
0.342 | 0.879 | 0.67 | 0.0205 | 5.84e−05 | 0.571 | 0.2198 | 0.1003 |
Source | NcM6 | NcM8 | NcM9 | NcM12 | NcM18 | NcM20 | NcM25 | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Comparison |
mean ± SE | NcM6a | NGMb | mean ± SE | NcM8a | NGMb | mean ± SE | NcM9a | NGMb | mean ± SE | NcM12a | NGMb | mean ± SE | NcM18a | NGMb | mean ± SE | NcM20a | NGMb | mean ± SE | NcM25a | NGMb |
NcM6 | 5.8 ± 0.7 | Ref | <0.001 | 10.8 ± 0.7 | 1.0 | 0.6302 | 15.8 ± 1.4 | 0.02654 | 1.0 | 15.8 ± 1.8 | 0.84529 | 0.41764 | 14.1 ± 4.2 | 0.723 | 0.93 | 12.5 ± 3.0 | 0.9786 | <1e−05 | 6.7 ± 1.7 | 1.0 | 0.3859 |
NcM8 | 10.8 ± 3.4 | 0.956 | 0.00641 | 11.7 ± 5.3 | Ref | 0.7559 | 10.0 ± 2.6 | 0.29024 | 0.9642 | 5.8 ± 1.4 | 0.03458 | 1.0 | 9.9 ± 2.1 | 1.0 | 1.0 | 9.2 ± 1.8 | 1.0 | <1e−05 | 22.5 ± 5.6 | 0.0711 | 0.9923 |
NcM9 | 0.8 ± 0.7 | 0.0956 | <0.001 | 3.3 ± 1.2 | 0.39 | 0.324 | 0.0 ± 0.0 | Ref | 0.0571 | 6.7 ± 3.3 | 0.05005 | 1.0 | 13.3 ± 5.0 | 0.845 | 0.98 | 2.5 ± 1.4 | 0.174 | <1e−05 | 6.7 ± 2.4 | 1.0 | 0.3861 |
NcM12 | 9.2 ± 3.0 | 0.997 | 0.00139 | 17.5 ± 3.2 | 0.756 | 1.0 | 22.5 ± 4.5 | <0.001 | 0.4818 | 21.7 ± 3.6 | Ref | 0.05008 | 10.7 ± 1.7 | 0.997 | 1.0 | 11.7 ± 1.9 | 0.9986 | <1e−05 | 15.0 ± 4.8 | 0.5534 | 0.9984 |
NcM18 | 9.2 ± 4.5 | 0.997 | 0.00304 | 8.3 ± 3.4 | 0.984 | 0.2928 | 20.8 ± 4.8 | 0.00216 | 0.7125 | 29.2 ± 7.9 | 0.63337 | 0.00142 | 8.2 ± 1.8 | Ref | 1.0 | 4.2 ± 0.7 | 0.4101 | <1e−05 | 1.7 ± 0.8 | 0.9984 | 0.0938 |
NcM20 | 7.5 ± 3.0 | 1.0 | 0.00300 | 8.3 ± 3.8 | 0.984 | 0.2929 | 8.3 ± 0.8 | 0.48166 | 0.821 | 2.5 ± 1.4 | 0.00731 | 0.97096 | 14.1 ± 2.7 | 0.731 | 0.935 | 10.0 ± 3.1 | Ref | <1e−05 | 13.3 ± 4.6 | 0.7350 | 0.9756 |
NcM25 | 1.7 ± 0.8 | 0.985 | <0.001 | 4.2 ± 1.4 | 0.505 | 0.0491 | 2.5 ± 1.4 | 0.99881 | 0.1598 | 5.0 ± 0.8 | 0.0239 | 0.99996 | 3.3 ± 1.1 | 0.855 | 0.61 | 2.5 ± 1.4 | 0.1741 | <1e−05 | 5.0 ± 2.8 | Ref | 0.2531 |
NGM | 32.5 ± 8.0 | <0.001 | Ref | 17.5 ± 2.5 | 0.756 | Ref | 14.2 ± 6.4 | 0.05703 | Ref | 6.7 ± 2.0 | 0.0499 | Ref | 9.9 ± 1.1 | 1.0 | Ref | 33.3 ± 3.1 | <0.001 | Ref | 18.3 ± 8.0 | 0.2531 | Ref |
Center | 5.8 ± 3.0 | 1.0 | <0.001 | 1.7 ± 1.4 | 0.214 | 0.0137 | 0.8 ± 0.7 | 1.0 | 0.0818 | 1.7 ± 0.8 | 0.00482 | 0.92278 | 6.6 ± 3.5 | 1.0 | 0.982 | 0.8 ± 0.7 | 0.0619 | <1e−05 | 0.0 ± 0.0 | 0.9756 | 0.0536 |
Notes: aThe preference percentage of the media where destination equaled source was used as a reference for comparing the means of each test media. bThe mean preference percentage of the NGM destination was used as a reference for comparing the means of each test media. Ref indicates reference media for comparison.
Figure 4:
Media preference assays. Plots are the percentage of the worms located on the media destinations 2 hours after placing worms in the center of the test assay plates. GLM was used to analyze the correlation between the destinations and percentages of worms migrating to the destinations for all the seven-media sources (

While we have shown that laboratory acclimated
From this sample, we observed at least two different nematode species. Of these, we then picked two adult nematodes (isofemales), which appeared similar in size to
We next characterized how
Brood size of
Media | Number of tested hermaphrodites | Total brood size (Mean ± SE) | Dunnett’s post hoc |
---|---|---|---|
NGM | 29 | 248.0 ± 9.7 | Control |
NcM6 | 38 | 200.2 ± 2.9 | <1e−10 |
NcM12 | 39 | 185.6 ± 7.7 | <1e−10 |
NcM18 | 38 | 227.7 ± 7.8 | <1e−10 |
Note: Yellow shading highlights the NGM control. Brood sizes were lower on NcM plates. The standard errors (SE) and error bars for each data set are the SE among P0 batches and not the SE across individual P0s.
Lifespan of
Media | Number of tested hermaphrodites | Lifespan (days) Mean ± SE | Log-rank |
---|---|---|---|
NGM | 90 | 13.41 ± 0.26 | Control |
NcM6 | 96 | 18.97 ± 0.35 | <2e−16 |
NcM12 | 83 | 18.81 ± 0.63 | 9.4e−16 |
NcM18 | 92 | 17.93 ± 0.41 | <2e−16 |
Note: Yellow shading highlights the NGM control. Lifespans were longer on NcM plates.
Number of surviving
Number of surviving worms | ||||
---|---|---|---|---|
Day | NGM | NcM6 | NcM12 | NcM18 |
1 | 90 | 96 | 83 | 92 |
2 | 90 | 96 | 83 | 92 |
3 | 90 | 96 | 83 | 92 |
4 | 90 | 96 | 83 | 92 |
5 | 86 | 96 | 83 | 92 |
6 | 86 | 96 | 83 | 92 |
7 | 86 | 95 | 83 | 92 |
8 | 85 | 95 | 77 | 87 |
9 | 85 | 93 | 73 | 86 |
10 | 85 | 93 | 69 | 86 |
11 | 81 | 93 | 68 | 85 |
12 | 64 | 91 | 60 | 83 |
13 | 46 | 91 | 60 | 83 |
14 | 29 | 91 | 60 | 74 |
15 | 15 | 81 | 59 | 69 |
16 | 6 | 71 | 58 | 62 |
17 | 3 | 64 | 58 | 60 |
18 | 0 | 59 | 56 | 51 |
19 | 51 | 51 | 36 | |
20 | 41 | 50 | 25 | |
21 | 28 | 47 | 17 | |
22 | 8 | 36 | 9 | |
23 | 5 | 15 | 1 | |
24 | 0 | 1 | 0 | |
25 | 0 |
Figure 5:
Growth assays of

To determine the amount saved when using NcMs compared to NGM, we calculated the cost per liter of media, which can make approximately one hundred 6-cm plates, for all NcMs (Table 2). In Vietnam, the media costs of the three best NcMs (NcM8, NcM12, and NcM18) and NcM6 were $1.70 to $1.87 US per liter, which was approximately two-third of the cost for NGM ($2.00 US).
Approximate cost of reagents for making 1 L of media or approximately one hundred 6-cm plates.
Costa (VND) | |||||
---|---|---|---|---|---|
Components (amount/L) | NcM6 | NcM8 | NcM12 | NcM18 | NGM |
Cholesterol (1 mL of 5 mg/mL) | 200 | ||||
Plant cooking oil (100 µL) | 2 | ||||
Chicken egg (0.56 g) | 56 | 56 | |||
Pig fat (0.4 g) | 28 | ||||
Autoclaved mushroom (20 mL) | 115 | 115 | 115 | 115 | |
Peptone (2.5 g) | 3000 | ||||
Pure mineral mixture (1 mL of 1 M CaCl2, 1 mL of 1 M MgSO4, 25 mL of 1 M KPO4) | 3788 | 3788 | |||
Soil solution (10 mL) | 0 | 0 | 0 | ||
Agar (17 g) | 34,000 | 34,000 | 34,000 | 34,000 | 34,000 |
NaCl (4 mL of 0.75 g/ mL) | 3,000 | 3,000 | 3,000 | 3,000 | 3,000 |
Distilled water with reverse osmosis (1 L) | 2,000 | 2,000 | 2,000 | 2,000 | 2,000 |
Total cost in VND | 39,117 | 42,959 | 39,171 | 39,143 | 45,988 |
Total cost in US$b | 1.70 | 1.87 | 1.70 | 1.70 | 2.00 |
Notes: aCost in Vietnam Dong (VND) based on current prices on May 31, 2020 in Hanoi, Vietnam. bBased on the exchange rate (23,000 VND to $1 US on May 31, 2020.
We have tested 25 new NcMs for rearing
In general, the success of the three best NcMs and NcM6 makes sense based on their composition compared to that of the unsuccessful NcMs. Each of the four had presumptive replacements for cholesterol (egg, pig fat, or mushroom), minerals (soil, except NcM8 which had the standard worm mineral mixture), and peptone (mushrooms). The other NcMs were missing one or more of these components. Based on a report that
The NcM components are not completely defined, and thus, there are two issues. First, in addition to the intended replacement elements, there are likely other unknown elements. For example, our sample soil was associated with vegetation, so it likely had organic compounds from plants, animals, and living microorganisms (Flaig, 1971). These compounds could provide more nutritional factors for both OP50 and
While
First, we found that
Second, we were able to isolate and raise a wild strain of
In many insects, the adults seem to prefer the host species (usually plant) on which they grew up as larvae (Davis and Stamps, 2004). Related, prior studies have shown that when adult
NcMs were cheaper than NGM but depending on local markets, the cost reduction will obviously vary. In Vietnam, the cost of 1 L of NGM, which makes approximately one hundred 6-cm plates, is about $2.00 US (Table 2). The costs of 1 L of NcM6, NcM8, NcM12, and NcM18 range from $1.70–1.87 US, which is equivalent to a savings of 6.5–15% ($0.13–$0.30 US; Table 2). These four NcMs notably lacks peptone, which is one of the more expensive reagents in Vietnam. If disposable plastic Petri plates are used ($17–26 US for 100 plates), then the savings for 100 plates would be modest, 0.5–1.6%. This cost can be reduced if reusable glass Petri plates are used, as we did in this series of experiments. Glass Petri plates are an expensive one-time initial setup cost ($100–130 US per 100 plates), but subsequent usage is the price of washing, which we estimate to be about $3.00 US (for 100 plates; labor, water, and electricity in Vietnam). In this case and ignoring the setup cost, the financial savings is still appreciable, 2.6–6.0%. The prices of hardware and labor also vary globally, therefore each lab’s real savings may differ from our calculation. Nevertheless, NcMs should always be cheaper than NGM.
A related issue is the availability of the components, especially the mushrooms. While oyster mushrooms seem more global, fresh straw mushrooms may be harder to find outside of Asia. A financially equivalent mushroom (or reagent) will need to be identified in such countries.
We have developed three cheaper NcM recipes that can replace NGM. The components of these NcMs can be obtained in many places. Nevertheless, eggs should be the easiest to find in markets everywhere, so we recommend NcM12 as it has the fewest components and is the cheapest for researchers with limited budgets who study