Rice (
Compared with other phytopathogens, nematodes are difficult to control because they attack belowground parts of plants, resulting in reduced growth and yield loss (Williamson and Hussey, 1996). Moreover, nematodes are polyphagous pests that attack over 5,500 plant species, including several economically important crops (Moens and Perry, 2009; Ali et al., 2015; Ali et al., 2019). Successful control of
Several molecular techniques are available for the identification of
Accurate identification of
A survey of rice-growing areas of Faisalabad and Chiniot districts of central Punjab, Pakistan, was conducted during September 2014, 2015, and 2016. Five root samples of rice plants and 1000-ml composite soil samples were collected from each sampling site, preserved in polythene bags, and labeled. The samples were transported to the Nematology Lab, Department of Plant Pathology, University of Agriculture, Faisalabad, for further processing. The roots were gently washed with distilled water to remove adhering soil and plant debris. Nematode prevalence was determined by using the formula of Norton (1978):
Second-stage juveniles (J2s) of
Data were subjected to statistical analysis using Statistix (Ver. 8.1). The experimental design for the analysis of galling index, juveniles/soil sample, juveniles/root sample, stylet, and non-stylet-bearing nematodes was by a completely randomized block design with treatment means separated using a LSD test at
Isolates derived from single egg masses were used to extract DNA. Twenty larvae were picked, rinsed thrice with sterile distilled water, transferred to a microcentrifuge tube, and crushed in 500 µL of SDS extraction buffer containing Tris–HCl (1 M, pH 7.5), EDTA (0.5 M, pH 8.0), SDS (10% w/v), and dd H2O with a grinding plastic stick (Mitkowski et al., 2003). Proteins in the solution were digested by adding 20 µL proteinase K, 100 µg ml−1. Later, 500 µL of phenol (25:24:1, phenol/chloroform/isoamyl alcohol) was added and vortexed briefly. The tube was centrifuged at 14,000 rpm for 5 min and the supernatant was collected and transferred to another sterile microcentrifuge tube. Sodium acetate (3 M), 50 µL and ice-cold isopropanol, 500 µL, were added to the supernatant, vortexed gently, and centrifuged at 14,000 rpm for 5 min. The supernatant was discarded to save the pellet. Five-hundred µL of ethanol (96%) was added to the pellet and centrifuged for 3 min at 13,000 rpm. The supernatant was discarded again, and the pellet air-dried in a laminar flow chamber for 2 hr. DNA was dissolved in 30 µL of TE buffer (1 ml of 1 M Tris base (pH 8.0) and 0.2 ml of EDTA (0.5 M), dd H2O) and stored at –20°C until required for PCR reactions.
The PCR reaction mixture was prepared by using 10 µL of 10X PCR buffer, 2-µL dNTPs (10 mM), 2-µL forward primer (10 µM), 2-µL reverse primer (10 µM), 2-µL template DNA (> 50 ng), 1-µL Taq polymerase, and 81-µL ddH2O, for a total reaction volume of 100 µL. PCR reactions were carried out in a thermal cycler (BIO-RAD T100TM) under the following conditions: (1) predenaturation at 94 °C for 5 min, (2) denaturation at 94°C for 1 min, (3) annealing at 64°C for 1 min, (4) extension at 72°C for 1 min, (5) 35 cycles of this process, and (6) final extension at 72°C for 5 min. The sequences of primers used for amplification of the internal transcribed spacer region are 1) forward primer rDNA2 (5’–TTGATTACGTCCCTGCCCTTT–3’) (Vrain et al., 1992) and reverse primer rDNA1. 5.8 s (5’–ACGAGCCCGAGTGATCCACCG–3’) (Cherry et al., 1997). Primers were synthesized by Sigma Genosys Inc, St. Louis, MO, USA.
The amplified PCR product was viewed on a gel stained with ethidium bromide under a UV transilluminator. DNA was excised from the gel and purified for sequencing using quick Gel Extraction Kit (Qiagen Gel Extraction Kit, Qiagen, Hilden, Germany). Purified DNA was sent for sequencing to L.G.C. Genomics, Germany, or the DNA sequencing center at Brigham Young University, Provo, Utah, USA.
Due to the high degree of interspecific variation in nucleotide sequences of nematodes (Hu and Gasser, 2006), the deduced internal transcribed spacer region sequences were used for phylogenetic study. The ITS sequences of the eight isolates were used to query the most similar curated sequences on GenBank by performing open-nucleotide BLAST (Basic Local Alignment Search Tool, Camacho et al., 2009). The nearest matches as well as those from closely related species of
The field survey data during the rice cropping season of 2014, 2015, and 2016 indicated that both districts Chiniot and Faisalabad have
Prevalence of
Prevalence | |||||||
---|---|---|---|---|---|---|---|
Sr # | Locations | Elevation | Latitude | Longitude | 2014 | 2015 | 2016 |
1 | 133 J.B. | 178 V | 31.57931 | 072.97683 | − | − | − |
2 | 134 J.B. | 173 V | 31.59705 | 072.96338 |
|
+ | + |
3 | 223 J.B. | 169 V | 31.62043 | 072.96727 | − | − | − |
4 | Moza Rajoya | 176 R | 31.66198 | 072.97448 |
|
+ | + |
5 | M.Thattian | 184 R | 31.68778 | 072.97489 | − | − | − |
6 | M. Johdpur | 180 R | 31.69026 | 072.97472 | − | − | − |
7 | Ahmad Nagar | 182 R | 31.77321 | 072.89966 | − | − | − |
8 | Ahmad Pur | 187 R | 31.79090 | 072.87729 | − | − | − |
9 | M. kanwewala | 183 R | 31.81763 | 072.82544 | − | − | − |
10 | Moza Judhi | 186 R | 31.82471 | 072.81122 | − | − | − |
11 | 202 J.B. | 192 V | 31.84161 | 072.83868 | − | − | − |
12 | Kote Qazipur | 190 R | 31.84774 | 072.84970 | − | − | − |
13 | Biewal | 187 R | 31.90920 | 072.94682 | − | − | − |
14 | Kalowal | 182 R | 31.90423 | 072.95624 | − | − | − |
15 | Jand wala | 185 R | 31.88589 | 072.99015 | − | − | − |
16 | Pungu Morr | 184 R | 31.84625 | 072.96008 |
|
+ | + |
17 | Moza Johdabad | 183 R | 31.83006 | 072.93907 | − | − | − |
18 | M.Hussainabad | 188 R | 31.82157 | 072.92782 |
|
+ | + |
19 | M.Mohsanabad | 178 R | 31.79400 | 072.89456 | − | − | − |
20 | Moza Vaisaan | 176 R | 31.78678 | 072.88346 | − | − | − |
21 | 241 J.B. | 178 V | 31.72044 | 072.95988 | − | − | − |
22 | Moza Bukharian | 177 R | 31.70576 | 072.95381 | − | − | − |
23 | Abbas nagar | 180 R | 31.68935 | 72.93636 | − | − | − |
24 | Kandiwal | 177 R | 31.67671 | 72.90760 | − | − | − |
25 | 241 J.B. | 179 V | 31.66678 | 72.87928 | − | − | − |
26 | Thatta Jahania | 177 R | 31.66310 | 72.86660 |
|
+ | + |
27 | Adil wala bangla | 169 V | 31.66029 | 72.85530 | − | − | − |
28 | 194 J.B. | 171 V | 31.65541 | 72.83943 | − | − | − |
29 | 94 J.B. | 179 V | 31.64864 | 72.82515 | − | − | − |
30 | 202 J.B. | 179 V | 31.62264 | 72.77077 |
|
+ | + |
31 | Moza Nitthar | 167 R | 31.59611 | 72.70949 | − | − | − |
32 | 254 J.B. | 168 V | 31.58803 | 72.69275 | − | − | − |
33 | Jamya abad | 168 T | 31.55409 | 72.64627 |
|
+ | + |
34 | Gondlan wali | 167 R | 31.53430 | 72.66215 | − | − | − |
35 | Chenab mills Ltd | 166 C | 31.51384 | 72.67929 | − | − | − |
36 | Bhawana city | 170 C | 31.50520 | 72.68622 | − | − | − |
37 | 129 J.B. | 172 V | 31.50039 | 72.69027 | − | − | − |
38 | 41 J.B. | 165 V | 31.49171 | 72.69737 | − | + | + |
39 | 223 J.B. | 169 V | 31.45835 | 72.72484 | − | − | + |
40 | Rahmuana | 181 V | 31.42409 | 72.75250 | − | − | − |
Note: Villages with official code (V), JB, stand for canal irrigation official code. R stands for River Chenab basin areas and C stands for City/ Town area. Positive (+) sign indicates presence of RKN; negative (−) indicates absence of RKN in the rice field.
Prevalence of
Prevalence | |||||||
---|---|---|---|---|---|---|---|
Sr # | Locations | Elevation | Latitude | Longitude | 2014 | 2015 | 2016 |
1 | 217 R.B. | 175 V | 31.44325 | 073.00077 | − | − | − |
2 | 61 J.B. | 176 V | 31.45346 | 072.97887 | − | − | − |
3 | 57 J.B. | 177 V | 31.45328 | 072.98147 | − | − | − |
4 | 58 J.B. | 186 V | 31.46937 | 072.99122 |
|
|
|
5 | 52 J.B. | 181 V | 31.49570 | 073.00120 | − | − | − |
6 | 54 J.B. | 186 V | 31.500394 | 072.99582 | − | − | − |
7 | 51 J.B. | 180 V | 31.51203 | 072.98117 | − | − | − |
8 | 53 J.B. | 180 V | 31.52299 | 072.97618 | − | − | − |
9 | 49 J.B. | 186 V | 31.56101 | 072.98678 | − | − | − |
10 | 218 J.B. | 173 V | 31.43074 | 072.97399 |
|
|
|
11 | 64 J.B. | 173 V | 31.39198 | 072.93964 | − | − | − |
12 | 68 J.B. | 174 V | 31.37310 | 072.92706 | − | − | − |
13 | 66 J.B. | 178 V | 31.40154 | 72.97310 | − | − | − |
14 | 275 J.B. | 169 V | 31.34735 | 72.83235 | − | − | − |
15 | 70 J.B. | 181 V | 31.36304 | 72.90952 | − |
|
|
16 | 289 R.B. | 172 V | 31.33934 | 072.99238 | − | − | − |
17 | 245 R.B. | 177 V | 31.33586 | 073.01232 | − | − | − |
18 | 296 R.B. | 179 V | 31.33620 | 073.04997 | − | − | − |
19 | 254 R.B. | 166 V | 31.33576 | 073.00168 | − | − | − |
20 | 269 R.B. | 167 V | 31.19880 | 072.99097 | − | − | − |
21 | 135 G.B. | 169 V | 31.14848 | 072.98298 | − | − | − |
22 | UAF | 179 C | 31.43735 | 073.07427 |
|
|
|
23 | Samundari City | 168 C | 31.05557 | 072.97504 | − | − | − |
24 | 71 G.B. | 165 V | 31.05584 | 072.97427 | − | − |
|
25 | 73 G.B. | 165 V | 31.05005 | 072.99210 | − | − | − |
26 | 442 G.B. | 172 V | 31.04441 | 073.00982 |
|
|
|
27 | 393 G.B. | 172 V | 31.02308 | 073.07303 | − | − | − |
28 | 423 G.B. | 178 V | 31.07426 | 073.13823 | − | − | − |
29 | 424 G.B. | 172 V | 31.08084 | 073.14034 |
|
|
|
30 | 430 G.B. | 171 V | 31.11562 | 073.15054 | − | − | − |
31 | 172 G.B. | 178 V | 31.14319 | 073.14831 | − | − | − |
32 | 171 G.B. | 178 V | 31.16456 | 073.13882 | − | − | − |
33 | 39 G.B. | 176 V | 31.20585 | 073.17356 |
|
|
|
34 | 41 G.B. | 182 V | 31.20572 | 073.17418 | − | − | − |
35 | 54 G.B. | 183 V | 31.26873 | 073.29616 | − | − | − |
36 | 21 G.B. | 191 V | 31.30716 | 073.38556 | − | − | − |
37 | 205 R.B. | 186 V | 31.43253 | 073.23050 |
|
|
|
38 | 66 G.B. | 181 V | 31.34015 | 073.33852 |
|
|
|
39 | 216 R.B. | 183 V | 31.38091 | 073.22599 | − | − | − |
40 | 229 R.B. | 184 V | 31.39439 | 073.20733 |
|
|
|
Note: Villages with official code (V), JB, RB and GB stand for canal irrigation official code. C indicates a City/ Town area. Positive (+) sign indicates presence of RKN and negative (−) indicates absence of RKN in the rice field.
GPS map of Faisalabad and Chiniot districts. Red dots indicate locations of samples infested with
Rice roots infected with
The severity of
The infection of
The morphological examination of perineal patterns among obtained isolates showed that they were oval to circular shaped, dorsoventral, moderate in height of the arc, and with no lateral incisures or gaps. The tail tip showed prominent, coarse, and well-separated striae. The obtained perineal patterns were similar to previously described patterns for
Perineal pattern of
PCR amplification and sequencing yielded eight unique sequences. The isolates gave similar-sized bands of 326–328 bp on a gel stained with ethidium bromide (Figure 4). GenBank accession numbers for each of the obtained sequences are given in Tables 3–6.
Incidence of
Year | Location | Galling index | Juveniles/root sample | Juveniles/soil sample | Stylet bearing nematodes | Non-stylet bearing nematodes |
---|---|---|---|---|---|---|
2014 | 134 J.B | 2.20 b | 300.80 b | 140.40 d | 4.20 bc | 2.80 e |
Moza Rajoya | 3.80 a | 348.60 ab | 280.80 b | 3.80 c | 9.40 cd | |
Pungu Mor | 2.60 ab | 290.40 b | 108.80 d | 1.60 d | 11.40 bcd | |
Jamya Abad | 3.20 ab | 390.40 a | 119.00 d | 3.80 c | 12.00 bc | |
Jandwala | 4.00 a | 297.20 b | 211.40 c | 5.20 ab | 8.40 d | |
223 JB-2 | 3.80 a | 336.60 ab | 347.20 a | 5.80 a | 14.00 ab | |
Rahmuana | 3.20 ab | 294.00 b | 184.00 c | 5.40 ab | 17.20 a | |
2015 | 134 J.B | 3.40 a | 172.20 a | 117.80 f | 6.20 cd | 7.20 d |
Moza Rajoya | 3.20 a | 117.40 c | 242.60 c | 2.80 f | 9.20 cd | |
Pungu Mor | 2.80 a | 163.20 ab | 136.40 e | 7.40 bc | 13.00 a | |
Jamya Abad | 3.20 a | 126.40 bc | 135.80 e | 9.20 a | 10.00 bc | |
Jandwala | 2.80 a | 156.80 abc | 107.00 g | 5.80 de | 10.40 bc | |
223 JB-2 | 3.20 a | 134.00 abc | 194.60 d | 4.80 e | 9.20 cd | |
Rahmuana | 3.60 a | 130.80 abc | 279.60 b | 7.80 b | 11.80 ab | |
202 JB | 3.40 a | 131.80 abc | 292.20 a | 7.40 bc | 10.40 bc | |
2016 | 134 J.B | 3.40 ab | 278.00 bc | 218.00 b | 5.20 c | 4.00 c |
Moza Rajoya | 3.20 ab | 268.60 c | 298.80 a | 9.00 a | 10.20 ab | |
Pungu Mor | 2.80 b | 332.80 abc | 185.20 e | 8.20 ab | 7.20 bc | |
Jamya Abad | 3.00 b | 349.40 abc | 213.80 bc | 7.40 b | 9.40 ab | |
Jandwala | 3.40 ab | 380.80 a | 199.20 d | 5.80 c | 8.80 b | |
223 JB-2 | 4.20 a | 292.60 bc | 172.60 f | 5.20 c | 9.00 b | |
Rahmuana | 3.80 ab | 280.80 bc | 211.40 bc | 5.60 c | 6.80 bc | |
202 JB | 3.80 ab | 362.00 ab | 204.80 cd | 5.00 c | 8.00 b | |
129 JB | 2.80 b | 330.60 abc | 187.20 e | 7.20 b | 12.60 a |
Note: The means followed by the same letters in a column are not significantly different by LSD test (
Incidence of
Year | Location | Galling index | Juveniles/root sample | Juveniles/soil sample | Stylet bearing nematodes | Non-stylet bearing nematodes |
---|---|---|---|---|---|---|
2014 | 58 J.B. | 2.60 b | 334.80 ab | 157.20 e | 5.60 bc | 9.00 c |
218 R.B. | 3.60 ab | 352.20 a | 131.60 g | 4.80 cd | 8.80 c | |
70 J.B. | 1.40 c | 340.00 a | 219.80 b | 4.80 cd | 11.00 ab | |
442 G.B. | 3.60 ab | 332.40 ab | 147.60 f | 4.80 cd | 10.60 abc | |
39 G.B. | 3.00 b | 266.20 b | 238.00 a | 6.00 abc | 10.00 bc | |
424 G.B. | 2.60 b | 352.60 a | 172.20 d | 6.40 ab | 9.20 bc | |
205 R.B. | 3.20 ab | 320.00 ab | 184.00 c | 7.00 a | 12.00 a | |
UAF | 4.20 a | 280.80 ab | 113.60 h | 4.20 d | 10.40 abc | |
2015 | 58 J.B. | 2.60 ab | 336.00 a | 205.60 b | 5.40 cd | 9.20 c |
218 R.B. | 2.20 b | 342.20 a | 130.20 e | 5.20 cd | 8.80 c | |
70 J.B. | 3.00 ab | 331.00 a | 137.40 e | 4.20 d | 9.80 bc | |
442 G.B. | 2.40 ab | 338.40 a | 148.80 de | 5.20 cd | 9.80 bc | |
39 G.B. | 3.20 ab | 276.20 a | 185.00 bc | 7.80 a | 10.00 bc | |
424 G.B. | 3.80 a | 339.60 a | 128.60 e | 4.80 cd | 9.20 c | |
205 R.B. | 2.20 b | 330.60 a | 308.40 a | 7.00 ab | 10.60 abc | |
UAF | 3.40 ab | 292.60 a | 127.80 e | 5.80 bc | 9.40 bc | |
209 R.B. | 2.80 ab | 349.40 a | 172.60 cd | 8.20 a | 11.80 ab | |
66 G.B. | 2.60 ab | 352.80 a | 100.40 f | 7.20 a | 13.00 a | |
2016 | 58 J.B. | 2.00 d | 361.20 a | 106.80 g | 5.20 de | 9.00 bc |
218 R.B. | 2.40 cd | 340.00 ab | 90.60 h | 4.80 de | 9.60 abc | |
70 J.B. | 4.00 a | 340.00 ab | 190.80 b | 5.20 de | 10.40 abc | |
442 G.B. | 2.20 cd | 328.40 ab | 168.00 c | 9.00 a | 10.20 abc | |
39 G.B. | 3.20 bc | 277.80 b | 209.60 a | 5.00 de | 9.80 abc | |
424 G.B. | 3.40 ab | 394.00 a | 158.80 d | 7.20 abc | 8.80 bc | |
205 R.B. | 2.40 bcd | 362.00 a | 150.60 e | 4.20 de | 8.40 c | |
UAF | 3.20 abc | 380.80 a | 207.00 a | 6.00 bcd | 9.40 abc | |
209 R.B. | 2.80 bcd | 360.40 a | 120.20 f | 5.40 cde | 9.20 abc | |
66 G.B. | 3.40 ab | 368.60 a | 162.60 d | 7.60 ab | 10.80 ab | |
71 G.B. | 2.60 bcd | 358.00 a | 123.20 f | 3.60 e | 11.20 a |
Note: The means followed by the same letters in a column are not significantly different by LSD test (
Incidence of
Sr # | Local name | Botanical name | Juveniles /root sample | Juveniles/soil sample | Stylet bearing nematodes | Non-stylet bearing nematodes |
---|---|---|---|---|---|---|
1 | Della |
|
826.6 bc | 145.6 b | 11.2 de | 6.6 b |
2 | Madhana Grass |
|
700.8 cd | 100.0 de | 11.2 de | 4.4 cd |
3 | Barnyard grass |
|
4914.6 a | 424.0 a | 29.6 a | 9.4 a |
4 | False Daisy |
|
646.0 d | 100.6 de | 22.4 b | 6.4 bc |
5 | Knotgrass |
|
494.2 e | 91.2 e | 14.6 cd | 5.4 bcd |
6 | Toothed Dock |
|
783.8 cd | 121.0 cd | 23.0 b | 4.6 bcd |
7 | Jangli gai |
|
776.2 cd | 101.6 de | 18.8 bc | 5.0 bcd |
8 | Dumbi Sitti |
|
942.8 b | 129.4 bc | 8.4 e | 4.0 d |
9 | Cauliflower |
|
142.2 f | 43.4 g | 10.6 de | 3.4 d |
10 | Coriander |
|
143.8 f | 85.4 ef | 10.2 de | 3.6 d |
11 | Maithi |
|
178.6 f | 64.4 fg | 7.6 e | 5.2 bcd |
Note: The means followed by the same letters in a column are not significantly different by LS D test (
ITS sequences of
Location | Elevation | Latitude | Altitude | Isolate | GenBank Accession | Nucleotide |
---|---|---|---|---|---|---|
Rajoya | 176 | 31.66198 | 072.97448 | JB1CT | KX757064.1 | 326 bp |
UAF | 179 | 31.43735 | 073.07427 | JB2 UAF | KX757065.1 | 328 bp |
58 J.B | 186 | 31.46937 | 072.99122 | JB3FSD1 | KX757066.1 | 326 bp |
218 J.B | 173 V | 31.43074 | 072.97399 | JB3FSD2 | KX757067.1 | 326 bp |
442 G.B | 172 V | 31.04441 | 073.00982 | JB3FSD3 | MH057345.1 | 326 bp |
424 G.B | 172 V | 31.08084 | 073.14034 | JB3FSD4 | MH057346.1 | 326 bp |
205 R.B | 186 V | 31.43253 | 073.23050 | JB3FSD5 | MH057347.1 | 326 bp |
70 J.B | 181 V | 31.36304 | 72.909520 | JB3FSD6 | MH057348.1 | 326 bp |
ITS rDNA PCR amplification products using forward primer rDNA2 and reverse primer rDNA1.58 s. Isolate names are given in white text on the upper side of their respective band in the gel; DNA ladder is to the left of the gel.
Multiple alignment of ITS sequences from different isolates collected in Faisalabad and Chiniot. The NCBI Genbank accession numbers and isolate names are given in the start of sequences. Complete bars at the top of the sequences show the degree of conservation of different nucleotides in the ITS sequence among different isolates. Similarly, base conservation is also denoted by the capitalized nucleotide alphabet.
The Bayesian solution is presented in Figure 6. Bayesian posterior probabilities, represented as a percentage, are mapped at nodes where support is greater than 50%. The resulting phylogeny shows that six of the isolates sequenced in this study form a monophyletic clade with the other Asian isolates, including those from India, Nepal, China, and Vietnam. Isolate KX757067 belongs to an unresolved polytomy that contains isolates from Asia as well as Europe and South America. The relationships among the isolates are poorly resolved due to lack of synapomorphies. Three isolates from Pakistan, KX757067, MH057348, and MH057345, have several unique nucleotide substitutions, and thus longer branch lengths, relative to the other isolates of
Phylogenetic tree of
Chiniot and Faisalabad are agriculturally important and are considered some of the most fertile districts in Central Punjab. Rice is also cultivated in these districts with rice-wheat cropping systems. The results of this study reveal variation in the prevalence and infestation rate of
Morphological identification based on perineal patterns has been the standard criteria used to identify
To the best of our knowledge, this is the first report of ITS sequences of
Several studies have demonstrated that ITS sequencing is not only a useful diagnostic approach for
Our results confirmed that all Pakistani sequenced isolates of root-knot nematode collected from rice were
The rice-growing fields of Chiniot and Faisalabad, Central Punjab, Pakistan are infested with