The 18S small subunit (SSU) ribosomal DNA (rDNA) sequence is one of the most useful molecular loci for identifying agricultural invertebrates (Kiewnick et al., 2016). Small segments have been successfully used as barcodes (Floyd et al., 2002; Powers, 2004), and longer segments are standard molecular sequences for deep level phylogenetics. Single or multiple pairs of primers were reported to amplify nematode 18S SSU rDNA from different taxon templates (Table 1). Although the amplifications by these primers have been reproducible in other studies, no single or multiple universal pairs of primers applicable across all nematode taxa have been reported. The challenges remain for what primers and strategies should be selected, particularly when the specimens are from unknown species with limited amounts of extracted DNA. Three pairs of universal 18S SSU rDNA primers that have been successfully used for many years to amplify a relatively long sequence with diverse nematodes (Thomas et al., 1997) (Table 1) for direct de novo sequencing of rDNA have been problematic for certain nematode taxa in our laboratory. The PCR failures with the primers were seen in
Single pair or multiple pairs of primers frequently used for the amplification of near-full length 18S SSU rDNA.
Primers (old name) | Direction | Position | Single pair | Size | Reference | Note |
---|---|---|---|---|---|---|
SSU_F_04 (G18S4) | F | 963-983 | G18S4 and 18P | 1,723bp | Blaxter et al. (1998) | |
SSU_R_81 (18P) | R | 2667-2686 | Blaxter et al. (1998) | |||
Nem_SSU_F74 | F | 1006-1026 | Nem_SSU_F74 and 18P | 1,680bp | Blaxter et al. (1998), Donn et al. (2011) | |
G18S4 and 18S1573R | 1,522bp | Yaghoubi et al. (2016) | ||||
988F | F | 969-987 | 998F and 1912R, | 962bp | Holterman et al. (2006) | 1544–1711 bp generated by these three pairs (Holterman et al., 2006) |
1096F | F | 1076-1095 | 1096F and 1912R | 855bp | Holterman et al. (2006) | |
1912R | R | 1913-1931 | Holterman et al. (2006) | |||
1813F | F | 1795-1812 | 1813F and 2646R | 870bp | Holterman et al. (2006) | |
2646R | R | 2646-2665 | Holterman et al. (2006) | |||
18S965 | F | 1898-1920 | 18S965 and 18S1573R | 629bp | Mullin et al. (2005), Zeng et al. (2012) | 2,121bp generated by these three pairs (Zeng et al., 2012) |
18S1573R | R | 2506-2527 | Mullin et al. (2005), Zeng et al. (2012) | |||
SSUF07 | F | 972-990 | SSUF07 and SSUR26 | 889bp | Floyd et al. (2002), Zeng et al. (2012) | |
SSUR26 | R | 1841-1861 | Floyd et al. (2002), Zeng et al. (2012) | |||
18SnF | F | 1065-1089 | 18SnF and 18SnR | 1,591bp | Kanzaki and Futai (2002), Zeng et al. (2012) | |
18SnR | R | 2637-2656 | Kanzaki and Futai (2002), Zeng et al. (2012) | |||
18S39F (A or 39F) | F | 972-990 | 18S39F(39F) and 18S977R | 959bp | Blaxter et al. (1998), Olson et al. (2017) | 1,706bp generated by these two pairs (Olson et al., 2017) |
18S977R | R | 1910-1931 | Olson et al. (2017) | |||
18S900F | F | 1841-1861 | 18S900F and 18S1713R | 833bp | Olson et al. (2017) | |
18S1713R | R | 2652-2674 | Olson et al. (2017) | |||
18SF Cocktail or Remix: | F | 18SF Cocktail and 530R | 527bp | Thomas (2011) | 1,400–1,727bp generated by these three pairs (Thomas, 2011) | |
G18S4 | F | 963-983 | Blaxter et al. (1998) | |||
SSU_F_03 | F | 963-987 | Medlin et al. (1988) | |||
18S-82F | F | 969-988 | Lopez-Garcia et al. (2003) | |||
eukF(10) | F | 935-955 | Medlin et al. (1988) | |||
530R | R | 1470-1490 | ||||
385F | F | 1314-1333 | 385F and 1108R | 754bp | Thomas (2011) | |
1108R | R | 2047-2068 | ||||
550F | F | 1467-1488 | 550F and 18SR Cocktail | 1,200bp | Thomas (2011) | |
18SR Cocktail or Remix: | R | |||||
18P | R | 2667-2686 | Blaxter et al. (1998) | |||
eukR(10) | R | 2667-2690 | Medlin et al. (1988) |
F: Forward; R: Reverse; Position: in rDNA (X03680),
Designing new consensus 18S primers was initially based on a multiple alignment of 266 18S sequences extracted from GenBank, representing 124 nematode species across the Nematoda, including plant parasitic and non-parasitic species, with some specifically related to address the issues above. Ultimately, 276 18S sequences from major plant parasitic nematodes, including
Primers used for PCR and sequencing.
Primers | Direction | Sequence (5′-3′) | Tm (°C) | rRNA gene | PCR | Sequencing | Reference |
---|---|---|---|---|---|---|---|
18S-CL-F | F | TCAAAGATTAAGCCATGCAT | 53 | 18S | √ | √ | This study |
18S-CL-F2 | F | CTGTGATGCCCTTAGATGTCC | 58 | 18S | √ | √ | This study |
18S-CL-F3 | F | CTTGTCTCAAAGATTAAGCCATGCAT | 60 | 18S, ITS | √ | √ | This study |
18S-CL-F6 | F | TGAGAAATGGCCACTACGTC | 57 | 18S | √ | √ | This study |
18S-CL-R1 | R | ACCTTGTTACGACTTTTGC | 54 | 18S | √ | √ | This study |
18S-CL-R2 | R | GTTGAGTCAAATTAAGCCGCA | 57 | 18S | √ | This study | |
18S-CL-R5 | R | GCGGTGTGTACAAAGGGCAGGGAC | 67 | 18S | √ | This study | |
ITS-CL-F2 | F | ATTACGTCCCTGCCCTTTGTA | 59 | ITS, 28S | √ | √ | This study |
G18S4 | F | GCTTGTCTCAAAGATTAAGCC | 55 | 18S | √ | √ | Blaxter et al. (1998) |
530R | R | GCGGCTGCTGGCACCACACTT | 68 | 18S | √ | √ | Thomas (2011) |
550F | F | GGCAAGTCTGGTGCCAGCAGCC | 68 | 18S | √ | √ | Thomas (2011) |
1912R | R | TTTACGGTCAGAACTAGGG | 54 | 18S | √ | √ | Holterman et al. (2006) |
81R | R | TTCCTCCGCTAAATGATATGCTTAA | 58 | ITS | √ | √ | Reverse of 28S-81for (Holterman et al., 2008) |
D2AR | R | ACTTTCCCTCACGGTACTTGT | 59 | ITS | √ | √ | Reverse of D2A (Nunn, 1992) |
AB28 | R | ATATGCTTAAGTTCAGCGGGT | 57 | ITS | √ | √ | Joyce et al. (1994) |
VRAIN 2R (V2R) | R | TTTCACTCGCCGTTACTAAGGGAATC | 63 | ITS | √ | √ | Vrain et al. (1992) |
28S-1006rev (1006R) | R | AGGGGCGAAAGACTAATCGAAC | 60 | ITS, 28S | √ | √ | Holterman et al. (2008) |
28S-1032rev (1032R) | R | TCGGAAGGAACCAGCTACTA | 57 | ITS, 28S | √ | √ | Holterman et al. (2008) |
Specimens were mechanically disrupted in 20 µl of extraction buffer (Thomas et al., 1997) then stored in PCR tubes at –80°C until needed. Extracts were prepared from thawed pools by incubating the tubes at 60°C for 60 min., followed by 95°C for 15 min. to deactivate proteinase K. Two microliters of the extract was used for each 25 µl PCR reaction within a Bio-Rad MJ Mini or C1000 Touch gradient thermal cycler (Bio-Rad Laboratories, Hercules, CA): TaKaRa Ex Taq 10XEx Taq Buffer 5 μl dNTP mixture (2.5 mM each) 4 μl 10 μM forward primer 1 μl 10 μM reverse primer 1 μl TaKaRa Ex Taq (5 units/μl) 0.25 μl 18S template DNA (>1,000bp) 4 μl Sterilized distilled water up to 34.75 μl Invitrogen Platinum Taq 10X PCR Buffer, – Mg 2.5 μl 50 mM MgCl2 0.75 μl 10 mM dNTP mix 0.5 μl 10 μM forward prime 0.5 μl 10 μM reverse primer 0.5 μl 18S template DNA(<1,000bp) 2 μL Platinum™ Taq 0.1 μl Water, nuclease-free to 18.15 μl Phusion Taq 5X Phusion HF Buffer 10 µl 10 mM dNTPs 1 µl 10 µM forward primer 2.5 µl 10 µM reverse primer 2.5 µl 18S template DNA 4 µl Phusion DNA polymerase 0.5 µl Water added up to 29.5 µl
One of the advantages of Phusion Taq is that its PCR is very rapid and can be done in less than 2 hr. It tends to generate multiple bands and the detergent in the buffer may interrupt sequencing downstream. Further evaluation may be advisable in particular circumstances.
For TaKaRa Ex Taq and 18S Template DNA (>1,000bp): 95°C for 3 min, 5X (94°C for 30′, 45°C for 40′, 72°C for 2 min), 40X (94°C for 30′,Ta (°C) for 40′, 72°C for 2 min), 72°C for 5 min, 4°C until finish.
For Invitrogen Platinum™ Taq and 18S Template DNA (<1,000bp): 95°C for 3 min, 35X (94°C for 30′, Ta (°C) for 40′, 72°C for 70′), 72°C for 5 min, 4°C until finish
For Phusion and 18S Template DNA (>1,000bp): 98°C for 30′, 35X (98°C for 10′, 59°C for 30′, 72°C for 90′), 72°C for 2 min, 4°C until finish.
PCR products were visualized with the Lonza FlashGelTM DNA system (VWR International, Radnor, PA) and then treated with ExoSAP-IT reagent (Affymetrix, Inc, Santa Clara, CA) according to the manufacturer’s protocol. DNA sequencing was performed with an ABI BigDye Terminator v3.1 kit and in an ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA) owned by the USDA Systematic Entomology Lab, Beltsville, MD.
The G18S4 universal primer is a critical forward primer used for the 18SF-Cocktail (Thomas, 2011) paired with 18P (Table 1), and is comparable to the new 18S-CL-F3 and 18S-CL-F primers (Tables 1,2):
18S-CL-F3 (26 nt, Tm = 60°C)
5′-
G18S4 (21 nt, Tm = 55°C)
5′-G
18S-CL-F (20 nt, Tm = 53°C)
5′-TCAAAGATTAAGCC
To study which primer among these three is a better candidate, the reverse primer D2AR, with no primer-template mismatches in
Position diagram of 18S primers constructed with pDRAW32 DNA analysis by AcaClone software.
After aligning the sequence results from Figure 1 with these three primer sequences above, it is evident that the lack of the 3′ end sequence (solid line above) in G18S4 (panel A) made this primer incapable of amplifying the 18S-ITS templates of
Comparison of 18S primers by the PCR amplification. (A) G18S4 and D2AR; (B) 18S-CL-F and D2AR; (C) 18S-CL-F3 and D2AR; M: DNA ladder (0.1-4.0kb); 1:
Forward primer 18S-CL-F3 was not only employed successfully for these four taxa but also for many more taxa than for 18S-CL-F (Table 3). The results in Table 3 also show that 18S-CL-F3 tolerated a wider and higher temperature range (50-58°C) than 18S-CL-F. The 18S-CL-F3 forward primer paired with universal reverse primers successfully amplified not only short length (500-1,000bp) but also long (1,000-2,900bp) 18S templates (Table 3 and Fig. 2). In addition to the taxa in Table 3,
Taxa tested successfully with our newly designed ribosomal primers or paired with universal ribosomal primers.
Taxon | Primer set | Amplified rRNA gene (length) | Ta (°C) | Taq |
---|---|---|---|---|
|
18S-CL-F/18S-CL-R1 | 18S (around 1,700bp) | 50–55 | Invitrogen™ Platinum™ |
|
18S-CL-F3/81R | 18S and ITS (around 2,400bp) | 58 | TaKaRa EX |
|
18S-CL-F3/D2AR | 18S and ITS (around 2,900bp) | 58 | TaKaRa EX |
|
18S-CL-F3/AB28 or V2R | 18S and ITS (around 2,400bp) | 59 | Phusion |
|
18S-CL-F6/81R | 18S and ITS (around 2,000bp) | 54 | TaKaRa EX |
|
18S-CL-F3/1912R | 18S (around 1,000bp) | 50 | Invitrogen™ Platinum™ |
|
18S-CL-F3/530R | 18S (530bp) | 50 | Invitrogen™ Platinum™ |
|
18S-CL-F2/1032R | ITS and 28S ( around 2,000bp) | 54 | TaKaRa EX |
|
ITS-CL-F2/1006R or 1032R | ITS and 28S ( around 2,000bp) | 54 | TaKaRa EX |
Generally, one to three universal primer sets are needed for near-full length 18S sequence (Table 1) and one universal primer set for the ITS region (Vrain et al., 1992). However, by using 18S-CL-F3, only one primer set was sufficient to cover both 18S and ITS rDNA regions. Additionally a single primer set, 18S-CL-F2 or ITS-CL-F2, could be used with either 28S primers 1032R or 1006R (Table 2), respectively, to amplify rDNA that previously needed two sets for the ITS (Vrain et al., 1992) or the D1D2D3 regions of 28S (Nunn, 1992).
The 18S primers, Tyl2F and Tyl4R were designed to detect plant parasitic and fungivorous nematodes by PCR-Denaturing Gradient Gel Electrophoresis (PCR-DGGE) (Kushida, 2013). While using PCR-DGGE can reduce cost and time, it provides very limited sequence information. The forward Tyl2F primer is positioned approximately 345bp after the new 18S-CL-F3, and paired with Tyl4R it generates only a 450bp 18S fragment. This contrasts with the new 18S-CL-F3 primer, capable of amplifying near-full length 18S to ITS rDNA.
The degenerate primer Nem_SSU_F74 (Donn et al. (2011) was also designed to remedy 5′ primer mismatches for problematic and unknown taxa, but degenerate primers may still underperform for certain taxa. However, these new consensus primers have less bias and improved fidelity to reveal sequences that cover all nematodes across the Tylenchida and Rhabditida. The new 18S-CL-F3 primer binds to position 964-989 on the reference
It should be noted that the utility of these ribosomal primers presented in this study are not limited to taxonomic identification and phylogenetic analysis using individual specimens. They can be used for biodiversity studies with metabarcoding from environmental DNA samples. The resulting amplicons can be sequenced using different NGS platforms, such as Illumina with short reads, and PacBio with long reads for long amplicons.