A Correlative Study of Vitamin D Receptor Variants Fok1, Apa1, Bsm1, and Taq1 Polymorphism and Vitamin D Deficiency with Higher Risk Ratio of Coronary Artery Disease in Female Population
, , , , , , et | 30 juin 2023
À propos de cet article
Article Category: Original Article
Publié en ligne: 30 juin 2023
Pages: 60 - 66
DOI: https://doi.org/10.2478/rjc-2023-0009
Mots clés
© 2023 Mahaboob Vali Shaik et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.
Primers used in the study and RFLP fragment sizes for VDR SNP genotyping.
| VDR gene Restriction site | Primers | RFLP fragments (bp) | Restriction enzyme |
|---|---|---|---|
| F:CAGAGCATGGACAGGGAGCAAG |
494, 293, 251, 201 | Taq I | |
| F:CAACCAAGACTACAAGTACCGCGTCAGTGA |
800, 650, 150 | Bsm I | |
| F:CAGAGCATGGACAGGGAGCAA |
740, 520, 220 | Apa I | |
| F:AGCTGGCCCTGGCACTGACTCTGCTCT |
96, 169, 265 | Fok I |
Taq I VDR gene polymorphism in cases and control subjects.
| Model | Genotype | Control N=100 | Cases N=100 | OR (95% CI) | |
|---|---|---|---|---|---|
| T/T | 27 (54%) | 46 (46%) | 1.00 | ||
| Co-dominant | T/t | 18 (36%) | 38 (38%) | 1.24 (0.59–2.58) | 0.64 |
| t/t | 5 (10%) | 14 (14) | 1.64 (0.53–5.07) | ||
| Dominant | T/T | 27 (54%) | 46 (46%) | 1.00 | |
| T/t-t/t | 23 (46%) | 53 (53%) | 1.33 (0.67–2.63) | 0.42 | |
| Recessive | T/T-T/t | 45 (90%) | 85 (85%) | 1.00 | |
| t/t | 5 (10%) | 14 (14%) | 1.50 (0.51–4.43) | 0.45 | |
| Over-dominant | T/T-t/t | 32 (64%) | 61 (61%) | 1.00 | |
| T/t | 18 (36%) | 38 (38%) | 1.13 (0.56–2.28) | 0.74 | |
| Allele | T | 72 (72%) | 132 (66%) | ||
| t | 28 (28%) | 68 (34%) | 1.30 (0.77–2.21) | 0.35 |
Apa-I VDR gene polymorphism in cases and control subjects.
| Model | Genotype | Control N=100 | Cases N=100 | OR (95% CI) | |
|---|---|---|---|---|---|
| A/A | 58 (58%) | 46 (46%) | 1.00 | ||
| Co-dominant | A/a | 26 (26%) | 31 (31%) | 1.50 (0.68–3.34) | |
| a/a | 16 (16%) | 21 (21%) | 1.65 (0.65–4.23) | 0.44 | |
| Dominant | A/A | 58 (58%) | 46 (46%) | 1.00 | |
| A/a-a/a | 42 (42%) | 53 (53%) | 1.56 (0.78–3.10) | 0.2 | |
| Recessive | A/A-A/a | 84 (84%) | 78 (78%) | 1.00 | |
| a/a | 16 (16%) | 21 (21%) | 1.43 (0.58–3.51) | 0.43 | |
| Over-dominant | A/A-a/a | 74 (74%) | 68 (68%) | 1.00 | |
| A/a | 26 (26%) | 31 (31%) | 1.32 (0.61–2.82) | 0.48 | |
| Allele | A | 142 (71%) | 126 (63%) | ||
| a | 58 (29%) | 74 (37%) | 1.45 (0.86–2.44) | 0.19 |
Demographics, clinical, and biochemical variables in cases and control subjects.
| Demographics | Controls (Mean±SD) | Cases (Mean±SD) | |
|---|---|---|---|
| Age | 49.5±16.5 | 51.65±17.5 | >0.05 |
| SBP | 115.5±7.5 | 116.5±8.5 | 0.0001 |
| DBP | 77.8±9.5 | 89.5±10.9 | 0.0001 |
| 25-hydroxy vitamin D (ng/ml) | 51.52±11.5 | 20.2±8.5 | 0.0001 |
| Fasting blood sugar (mg/dl) | 113.2±10.5 | 119.8±11.5 | >0.05 |
| Total cholesterol (mg/dl) | 185.5±20.8 | 255.5±50.5 | 0.0001 |
| Triglycerides (mg/dl) | 99.7±19.5 | 240.31±52.5 | 0.0001 |
| HDL-C (mg/dl) | 49.6±8.5 | 42.18±10.5 | 0.0001 |
| LDL-C (mg/dl) | 58.5±12.5 | 131.5±45.8 | 0.0001 |
| VLDL-C (mg/dl) | 21.3±10.6 | 49.9±11.2 | 0.0001 |
| hsCRP (mg/L) | 0.61±1.5 | 6.22±2.5 | >0.05 |
| Serum creatinine (mg/dl) | 0.85±0.075 | 0.92±0.08 | >0.05 |
Fok I VDR gene polymorphism in cases and control subjects.
| Model | Genotype | Control N=100 | Cases N=100 | OR (95% CI) | |
|---|---|---|---|---|---|
| F/F | 70 (70%) | 68 (68%) | 1.00 | ||
| Co-dominant | F/f | 14 (14%) | 29 (29%) | 2.16 (0.86–5.44) | |
| f/f | 16 (16%) | 2 (2%) | 0.13 (0.03–0.65) | 0.0018 | |
| Dominant | F/F | 70 (70%) | 68 (68%) | 1.00 | |
| F/f-f/f | 15 (30%) | 31 (31%) | 1.08 (0.52–2.26) | 0.84 | |
| Recessive | F/F-F/f | 84 (84%) | 97 (97%) | 1.00 | |
| f/f | 16 (16%) | 2 (2%) | 0.11 (0.02–0.54) | 0.0018 | |
| Over-dominant | F/F-f/f | 86 (86%) | 70 (70%) | 1.00 | |
| F/f | 14 (14%) | 29 (29%) | 2.58 (1.04–6.41) | 0.031 | |
| Allele | F | 144 (77%) | 166 (83%) | 0.67 (0.37–1.23) | |
| f | 46 (23%) | 34 (17%) | 0.21 |
Bsm I VDR gene polymorphism in cases and control subjects.
| Model | Genotype | Control N=100 | Cases N=102 | OR (95% CI) | |
|---|---|---|---|---|---|
| B/B | 62 (62%) | 61 (61%) | 1.00 | ||
| Co-dominant | B/b | 12 (12%) | 26 (26%) | 2.24 (0.83–6.01) | |
| b/b | 26 (26%) | 12 (12%) | 0.48 (0.19–1.17) | 0.029 | |
| Dominant | B/B | 62 (62%) | 61 (61%) | 1.00 | |
| B/b-b/b | 38 (38%) | 38 (38%) | 1.03 (0.51–2.08) | 0.93 | |
| Recessive | B/B-B/b | 37 (74%) | 86 (86%) | 1.00 | |
| b/b | 26 (26%) | 12 (12%) | 0.40 (0.17–0.95) | 0.039 | |
| Over-dominant | B/B-b/b | 88 (88%) | 73 (73%) | 1.00 | |
| B/b | 12 (12%) | 26 (26%) | 2.65 (1.01–6.94) | 0.035 | |
| Allele | B | 136 (68%) | 148 (74%) | ||
| b | 64 (32%) | 52 (26%) | 0.72 (0.42–1.23) | 0.27 |