Prevalence and characterisation of class 1 and 2 integrons in multi-drug resistant Staphylococcus aureus isolates from pig farms in Chongqing, China
, , , , , , et
16 sept. 2020
À propos de cet article
Publié en ligne: 16 sept. 2020
Pages: 381 - 386
Reçu: 04 mars 2020
Accepté: 24 août 2020
DOI: https://doi.org/10.2478/jvetres-2020-0061
Mots clés
© 2020 C. Ye et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1

Primers used in this study
Primer | Target gene | Sequence (5′–3′) | Product size (bp) |
---|---|---|---|
CCTCCCGCACGATGATC | 280 | ||
TCCACGCATCGTCAGGC | |||
TTATTGCTGGGATTAGGC | |||
ACGGCTACCCTCTGTTATC | 233 | ||
AGTGGGTGGCGAATGAGTG | 600 | ||
TGTTCTTGTATCGGCAGGTG | |||
variable region 1 | ACCGAAACCTTGCGCTCGT | Variable | |
AAGCAGACTTGACCTGAT | |||
CGGGATCCCGGACGGCATGCAC | |||
variable region 2 | GATTTGTA | Variable | |
GATGCCATCGCAAGTACGAG | |||
Different types of gene cassette amplicons among the integron-bearing S_ aureus
Types of integrons | Number of isolates carrying different cassettes (%) | Approximate sizes of amplicon (bp) | Inserted cassette(s) |
---|---|---|---|
25 (41.7%) | 1,200 | ||
Integron 1 | 1 (1.7%) | 2,000 | |
14 (23.3%) | 1,200, 2,000 | ||
Integron 2 | 58 (85.3%) | 700 |
Comparison of detection rates of class 1 and 2 integrons in plasmid and genomic DNA in pig farm-derived S_ aureus
Types of DNA | Class 1 integrons | Class 2 integrons | ||
---|---|---|---|---|
Number of positive (negative) strains | Positive rate (%) | Number of positive (negative) strains | Positive rate (%) | |
Genomic DNA | 25 (43) | 36.8 | 31 (37) | 45.6 |
Plasmid DNA | 60 (8) | 88.2 | 68 (0) | 100 |
χ2 | 38.43 | 50.83 | ||
P-value | <0.001 | <0.001 |
The prevalence of pig farm-derived S_ aureus
Sample sources | Number of samples from each source | Number of positive isolates (%) | Number of MRSA strains among the positive isolates (%) |
---|---|---|---|
Faeces | 426 | 43 (10.1%) | 35 (81.4%) |
Floor | 215 | 11 (5.1%) | 9 (81.8%) |
Water | 22 | 3 (13.6%) | 2 (66.7%) |
Feed | 20 | 6 (30.0%) | 6 (100%) |
Air | 41 | 5 (12.2%) | 5 (100%) |
Total | 724 | 68 (9.4%) | 57 (83.8%) |
Antibiotic-resistant phenotypes and genotypes of S_ aureus in this study
Antimicrobial subclass | Antimicrobial agent | Phenotypes (n = 68) | Genotypes (number of isolates containing different resistance gene cassettes) | |||
---|---|---|---|---|---|---|
Number of resistant isolates (%) | Number of sensitive isolates | Class 1 integron (n = 60) | Class 2 integron (n = 68) | |||
Penicillin | 68 (100) | - | - | - | 58 | |
β-lactams | Oxacillin | 60 (88.2) | - | - | - | 50 |
- | 8 | - | - | 8 | ||
Tetracyclines | Tetracycline | 68 (100) | - | - | - | - |
Macrolides | Erythromycin | 68 (100) | - | - | - | - |
46 (67.6) | - | - | - | - | ||
Phenicols | Chloramphenicol | - | 22 | - | - | - |
Folate pathway | 15 (22.1) | - | - | 2 | - | |
inhibitors | Trimethoprim-sulfamethoxazole | - | 53 | - | 12 | - |
7 (10.3) | - | - | - | - | ||
Lincosamides | Clindamycin | - | 61 | - | - | - |
Rifamycins | Rifamycin | 2 (2.9) | - | - | - | - |
- | 66 | - | - | - | ||
Aminoglycosides | Gentamicin | 1 (1.5) | - | 1 | - | - |
- | 67 | 39 | - | - | ||
Ciprofloxacin | 1 (1.5) | - | - | - | - | |
Quinolones | - | 67 | - | - | - | |
Levofloxacin | 1 (1.5) | - | - | - | - | |
- | 67 | - | - | - | ||
Nitrofurans | Nitrofurantoin | - | 68 | - | - | - |
Glycopeptides | Teicoplanin | - | 68 | - | - | - |