Plant-parasitic nematodes (PPNs) pose a significant risk to the health and visual quality of high amenity turfgrasses, particularly golf course putting greens which are constructed with a conducive sand-based root zone and are under intense stress from low mowing and aggressive maintenance practices (4). Control of PPNs on golf greens typically relies on the broadcast application of a nematicide. Many of these nematicide active ingredients, such as abamectin, have a low water solubility (Ks abamectin = 7.8 μg L−1) and high soil-organic carbon partitioning coefficient (KOC abamectin = 4000 mL g−1), leading to the molecule being tied up in the organic-matter rich thatch layer of golf course putting greens (11,31). As a result of this limited mobility, contact and subsequent control of a target PPN residing deeper in the soil profile is unlikely. As a further complication, the various species of PPNs specifically parasitic to turfgrass can be present both outside and inside the root, existing as migratory ecto-, sedentary endo- or semi-endoparasites. To combat limitations in nematicide efficacy, determining if and when PPN populations aggregate to a targetable depth is paramount.
Root-knot nematodes (
As a migratory ecto- and semi-endoparasitic PPN, the lance nematode feeds on both external and internal root tissue throughout its life cycle (29). Populations of lance nematodes on golf course putting greens have been observed to be either aggregated to the upper 5 cm of soil or evenly distributed throughout the upper 10 cm (34). Turfgrass parasitic root-knot nematode species, and the temperature requirements for their reproduction, have been documented; however, their vertical distribution within the soil beneath the turfgrass was not (21,13). Population shifts in agronomic crops such as peanuts and cotton have been recorded (25), while studies aimed at determining population fluctuation trends in turfgrass, particularly on bentgrass putting greens in the Midwest region, have yet to be conducted.
Effectively timing management strategies, particularly nematicide applications, require knowledge of the biology and seasonal occurrence of PPN populations. Nematicide applications timed when PPNs are shallow in the soil profile and just prior to a population spike would provide the highest chance of the nematicide molecule contacting the target PPN (9). This study serves as a benchmark for determining if the vertical distribution of PPNs on golf putting greens aggregates to a targetable depth during a given month in Missouri and Indiana, while building upon the knowledge base of studies conducted in other geographic locations. Additionally, this study aimed to speciate lance and root-knot nematode species on golf courses, putting greens in the Midwestern United States, specifically Missouri and Indiana, through DNA sequencing and scanning electron microscopy.
Sampling sites from both Missouri and eastern Kansas in 2021 and Indiana in 2022
1 | St. Louis | A4 | None | USGA | 6.9 | 1.3 | 40 | 82 | 471 |
2 | St. Louis | T1/A4 | None | USGA | N.A. | N.A. | N.A. | N.A. | N.A. |
3 | St. Louis | A1/A4 | Heat-killed |
Native | N.A. | N.A. | N.A. | N.A. | N.A. |
4 | Columbia | A1 | None | USGA | N.A. | N.A. | N.A. | N.A. | N.A. |
5 | Columbia | SR 1020 | Heat-killed |
USGA | 7.8 | 0.6 | 49 | 126 | 634 |
6 | Branson | Penn A1/A4 | None | USGA | N.A. | N.A. | N.A. | N.A. | N.A. |
7 | Cape Girardeau | Crenshaw | Fluopyram | USGA | N.A. | N.A. | N.A. | N.A. | N.A. |
8 | Mission Hills | A1/A4 | Fluopyram | USGA | 7.3 | 1.4 | 30 | 72 | 628 |
9 | Mission Hills |
A1/A4 ~10% POA |
Heat-killed |
USGA | 7.1 | 1.2 | 64 | 65 | 597 |
10 | Olathe | A4/Pure Distinction | Abamectin, Fluopyram | USGA | 7.2 | 1.3 | 53 | 62 | 678 |
1 | Newburgh | Cohansey | None | USGA | 7.4 | 1.1 | 20 | 51 | 476 |
2 | French Lick | Penn A1/A4 | None | USGA | 7.9 | 1.0 | 16 | 35 | 1335 |
3 | Columbus | Penncross | Abamectin | Native | 7.5 | 1.6 | 59 | 93 | 1373 |
4 | Indianapolis | Penncross ~20% Poa | None | USGA | 7.5 | 2.5 | 49 | 113 | 1478 |
5 | Noblesville | A1 | None | USGA | 7.8 | N.A. | N.A. | N.A. | N.A. |
6 | Chesterton | Penncross/Poa (50/50) | None | USGA | 7.8 | 1.2 | 21 | 77 | 890 |
7 | Bristol | A1/A4/Poa | Fluopyram | Native | 7.8 | 2.2 | 108 | 105 | 1809 |
8 | Fort Wayne | Penncross/Poa | None | USGA | 7.6 | 2.6 | 56 | 84 | 1609 |
9 | Fort Wayne | 007 | None | USGA | 7.5 | 1.6 | 40 | 138 | 1546 |
10 | West Lafayette | L 39 | None | USGA | 7.9 | 1.7 | 30 | 80 | 1518 |
Species and isolates of lance nematodes sequenced in the present study.
STL.1 | Kirkwood, MO | Bentgrass | A1/A4 | OR948481 | |
STL.2 | Kirkwood, MO | Bentgrass | A1/A4 | OR948484 | |
STL.3 | Kirkwood, MO | Bentgrass | A1/A4 | OR948486 | |
STL.4 | Kirkwood, MO | Bentgrass | A1/A4 | OR948495 | |
STL.5 | Kirkwood, MO | Bentgrass | A1/A4 | OR948498 | |
STL.6 | Kirkwood, MO | Bentgrass | A1/A4 | OR948501 | |
1.1 | Newburgh, IN | Bentgrass | Cohansey | OR948481 | |
1.2 | Newburgh, IN | Bentgrass | Cohansey | OR948496 | |
2.1 | French Lick, IN | Bentgrass | Penn A1/A4 | OR948472 | |
2.2 | French Lick, IN | Bentgrass | Penn A1/A4 | OR948480 | |
2.3 | French Lick, IN | Bentgrass | Penn A1/A4 | OR948482 | |
2.4 | French Lick, IN | Bentgrass | Penn A1/A4 | OR948500 | |
3.1 | Columbus, IN | Bentgrass | Penncross | OR948478 | |
3.2 | Columbus, IN | Bentgrass | Penncross | OR948493 | |
3.3 | Columbus, IN | Bentgrass | Penncross | OR948492 | |
4.1 | Indianapolis, IN | Bentgrass/~20% Poa | Penncross | OR948475 | |
4.2 | Indianapolis, IN | Bentgrass/~20% Poa | Penncross | OR948485 | |
5.1 | Noblesville, IN | Bentgrass | A1 | OR948476 | |
6.1 | Chesterton, IN | Bentgrass/Poa 50/50 | Penncross | OR948477 | |
6.2 | Chesterton, IN | Bentgrass/Poa 50/50 | Penncross | OR948487 | |
7.1 | Bristol, IN | Bentgrass/~20% Poa | A1/A4 | OR948497 | |
10.1 | West Lafayette, IN | Bentgrass | L 93 | OR948473 | |
10.2 | West Lafayette, IN | Bentgrass | L 93 | OR948474 | |
10.3 | West Lafayette, IN | Bentgrass | L 93 | OR948479 | |
10.4 | West Lafayette, IN | Bentgrass | L 93 | OR948483 | |
10.5 | West Lafayette, IN | Bentgrass | L 93 | OR948489 | |
10.6 | West Lafayette, IN | Bentgrass | L 93 | OR948490 | |
10.7 | West Lafayette, IN | Bentgrass | L 93 | OR948491 | |
10.8 | West Lafayette, IN | Bentgrass | L 93 | OR948494 | |
10.9 | West Lafayette, IN | Bentgrass | L 93 | OR948499 | |
10.10 | West Lafayette, IN | Bentgrass | L 93 | OR948502 | |
1.1 | Newburgh, IN | Bentgrass | Cohansey | PP034063 | |
2.1 | French Lick, IN | Bentgrass | Penn A1/A4 | PP034062 | |
4.1 | Indianapolis, IN | Bentgrass/~20% Poa | Penncross | PP034064 | |
4.2 | Indianapolis, IN | Bentgrass/~20% Poa | Penncross | PP034066 | |
5.1 | Noblesville, IN | Bentgrass | A1 | PP034061 | |
6.1 | Chesterton, IN | Bentgrass/Poa 50/50 | Penncross | PP034071 | |
7.1 | Bristol, IN | Bentgrass/~20% Poa | A1/A4 | PP034065 | |
7.2 | Bristol, IN | Bentgrass/~20% Poa | A1/A4 | PP034072 | |
8.1 | Fort Wayne, IN | Bentgrass/Poa 50/50 | Penncross | PP034067 | |
9.1 | Fort Wayne, IN | Bentgrass | 007 | PP034069 | |
10.1 | West Lafayette, IN | Bentgrass | L 93 | PP034060 | |
10.2 | West Lafayette, IN | Bentgrass | L 93 | PP034068 | |
10.3 | West Lafayette, IN | Bentgrass | L 93 | PP034070 |
The rDNA ITS region from morphologically identified lance nematodes was amplified with genus-level primer sequences Hoc-1f (5′- AACCTGCTGCTGGATCATTA-3′) and LSUD-03r (5′- TATGCTTAAGTTCAGCGGGT-3′) and were subsequently sequenced (1). The D2/D3 region of the 28S gene from morphologically identified root-knot nematodes was amplified with primer sequences ((RK28SF (5′- CGGATAGAGTCGGCGTATC-3′) and MR (5′- AACCGCTTCGGACTTCCACCAG-3′)) designed by Ye et al. (36). Amplification was conducted in a 25 μl mixture containing 10 μl of Taq Ready Mix (Sigma), 13 μl of nuclease-free water, 1 μl of DNA and 0.5 μl of each primer. PCR amplification of the ITS rDNA region of lance nematode samples was conducted with the following cycle design: initial denaturation at 95°C for 3 min, followed by 35 cycles of 95°C for 45 s, 59°C for 1 min 30 s, 72°C for 2 min and a final extension at 72°C for 10 min. PCR amplification of the D2/D3 region of root-knot nematode samples was conducted with the following cycle design: initial denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 94° for 30 s, 55°C for 45 s, 72°C for 1 min and a final extension at 72° for 10 min. Amplification was confirmed via electrophoresis on a 1% agarose gel. Amplicons were purified with ExoSAP-IT (ThermoFisher, Waltham, MA) following the manufacturer's recommendations and sent to Eurofins Genomics (Eurofins Genomics, Louisville, KY) for sequencing. Lance and root-knot sample DNA was also amplified using species-specific primers (Table 3) developed for
LSUD-03r | TATGCTTAAGTTCAGCGGGT | 60 | 1,030 | ||
Hs-1r | GCCAGTGTGTTCCGCTCGCA | 63.2 | 260 | ||
Hs-1f | CCTGCCTTGGGGGTCGCTTG | 63.7 | 260 | ||
HC-1r | TCAGCACACAATGGTACCTTT | 62 | 580 | ||
HG-2r | TCCTCGTTCACACATTGACA | 62 | 120 | ||
RK28SF | CGGATAGAGTCGGCGTATC | 55–60 | 612 | ||
MR | AACCGCTTCGGACTTCCACCAG | ||||
Mg28SFs | GATGTGCAGATATTTTCCGTCAAGG | 55–60 | 198 | ||
RK28SUR | CCCTATACCCAAGTCAGACGAT | ||||
MgmITSFs | GATCGTAAGACTTAATGAGCC | 55–60 | 323 | ||
RK28SUR | CCCTATACCCAAGTCAGACGAT | ||||
Mn28SFs | GTCTGATGTGCGACCTTTCACTAT | 55–60 | 272 | ||
RK28SUR | CCCTATACCCAAGTCAGACGAT | ||||
Inc-K14-F | CCCGCTACACCCTCAACTTC | 55–60 | 399 | ||
Inc-K14-R | GGGATGTGTAAATGCTCCTG |
Phylogenetic trees were developed with consensus sequences using ClustalW in MEGA (Pennsylvania State University, State College, PA). The ITS sequences of
Distribution of plant-parasitic nematode species sampled from creeping bentgrass putting greens in Missouri and eastern Kansas in 2021 and Indiana in 2022 in two independent pie charts. Samples were collected during the months of April, June, August and October of 2021 and 2022, respectively. “n” indicates total PPNs represented within each chart.
Type III Tests of Fixed Effects for both Missouri and eastern Kansas in 2021 and Indiana in 2022. Data were analyzed using PROC GLIMMIX in SAS 9.4
Lance | Depth | <.0001 | <.0001 |
Month | .0028 | .0003 | |
Depth x Month | .0487 | .4981 | |
Root-Knot | Depth | .0004 | <.0001 |
Month | .7918 | <.0001 | |
Depth x Month | .9998 | .5897 | |
Ring | Depth | <.0001 | <.0001 |
Month | <.0001 | <.0001 | |
Depth x Month | .0001 | <.0001 | |
Free-Living | Depth | <.0001 | <.0001 |
Month | .0538 | .0025 | |
Depth x Month | .0254 | <.0001 |
Missouri and eastern Kansas 2021 total nematode population densities by sampling depth and month with soil samples aggregated (100 cm3). Significance letters indicate significant differences between sampling depths by month analyzed within that individual species.
Lance | April | 81.9x | bcdey | 19.5 | de | 9.0 | e | 1.5 | e | 1.5 | e |
June | 144.0 | b | 85.5 | bcde | 18.0 | e | 10.5 | e | 10.5 | e | |
August | 147.6 | b | 110.7 | bc | 53.1 | cde | 33.6 | cde | 21.3 | cde | |
October | 309.0 | a | 105.6 | bcd | 27.0 | cde | 24.9 | cde | 10.8 | e | |
Root-Knot | April | 162.9 | * | 66.0 | * | 14.4 | * | 12.0 | * | 3.0 | * |
June | 97.5 | * | 39.0 | * | 4.5 | * | 3.0 | * | 13.5 | * | |
August | 114.6 | * | 25.5 | * | 5.1 | * | 4.5 | * | 9.0 | * | |
October | 185.4 | * | 62.1 | * | 11.4 | * | 8.1 | * | 15.9 | * | |
Ring | April | 21.9 | c | 27.0 | c | 21.0 | c | 3.0 | c | 3.9 | c |
June | 90.0 | cb | 64.5 | cb | 34.5 | cb | 13.5 | c | 18.0 | c | |
August | 171.3 | b | 97.5 | cb | 37.2 | cb | 17.7 | c | 23.1 | cb | |
October | 534.0 | a | 139.5 | cb | 62.7 | cb | 33.6 | cb | 18.3 | cb | |
Free-Living | April | 1188.9 | c | 238.5 | c | 80.4 | c | 43.8 | c | 43.8 | c |
June | 3178.5 | b | 429.0 | c | 189.0 | c | 114.0 | c | 90.0 | c | |
August | 3187.2 | b | 306.7 | c | 154.2 | c | 108.3 | c | 143.1 | c | |
October | 4653.0 | a | 351.8 | c | 186.9 | c | 100.5 | c | 119.8 | c |
Mean of nematode population densities per 100 cm3.
Means in the same column followed by the same letter are not different according to Fisher's protected LSD (
Indicates no significant depth by month interaction.
Indiana 2022 total nematode population densities organized by sampling depth and month with soil samples aggregated (100 cm3). Significance letters indicate significant differences between sampling depths by month analyzed within that individual species.
Lance | April | 30.0x | *y | 37.5 | * | 16.5 | * | 18.0 | * | 4.5 | * |
June | 16.5 | * | 63.0 | * | 13.5 | * | 4.5 | * | 3.0 | * | |
August | 51.0 | * | 54.0 | * | 43.5 | * | 34.5 | * | 15.0 | * | |
October | 10.5 | * | 19.5 | * | 16.5 | * | 6.0 | * | 4.5 | * | |
Root-Knot | April | 424.5 | * | 306.0 | * | 229.5 | * | 79.5 | * | 48.0 | * |
June | 145.5 | * | 67.5 | * | 19.5 | * | 4.5 | * | 0 | * | |
August | 282.0 | * | 132.0 | * | 28.5 | * | 27.0 | * | 22.5 | * | |
October | 70.5 | * | 55.5 | * | 18.0 | * | 9 | * | 7.5 | * | |
Ring | April | 189.0 | bcd | 58.5 | cde | 21.0 | de | 19.5 | de | 16.5 | e |
June | 337.5 | b | 153.0 | cde | 57.0 | de | 30.0 | de | 19.5 | de | |
August | 1017.9 | a | 220.5 | bc | 121.5 | cde | 61.5 | cde | 33.0 | de | |
October | 156.0 | cde | 57.0 | cde | 33.0 | de | 13.5 | e | 1.5 | e | |
Free-Living | April | 1591.5 | b | 316.5 | c | 129.0 | c | 73.5 | c | 58.5 | c |
June | 4144.5 | a | 405.0 | c | 132.0 | c | 60.0 | c | 28.5 | c | |
August | 3559.5 | a | 343.5 | c | 160.5 | c | 61.5 | c | 60.0 | c | |
October | 913.5 | bc | 147.0 | c | 67.5 | c | 43.5 | c | 30.5 | c |
Mean of nematode population densities per 100 cm3.
Means in the same column followed by the same letter are not different according to Fisher's protected LSD (P ≤ 0.05).
Indicates no significant depth by month interaction.
Phylogeny of the rDNA ITS region of
PCR results using
Morphological traits characteristic of
Scanning-electron micrographs of a lance nematode specimen collected form Site 5. A) four lip annules; B) the presence of an epiptygma; C) 25 longitudinal striae on the basal lip annule; and D) four lateral incisures.
Phylogeny of molecularly characterized
PCR results using
Populations of lance, root-knot, ring and free-living nematodes fluctuated throughout the season across all sampling sites and sampling depths. Other researchers have also demonstrated considerable variation in plant-parasitic nematode (PPN) populations seasonal dynamics (2,10,18,22,25,26). Some trends agree with one another despite differences in their cropping systems, and some are vastly different. In turfgrass, lance nematode population dynamics have been tied to soil temperature and natural reproductive cycles, while some studies demonstrated no association (18,26,33). The relationship between the decline of root-biomass and lance populations indicates a self-regulating feedback loop of PPN population density. As the competition for food increases through changes in nutrient density and root-decline, a constraint on the reproductive factor of the PPNs is more prevalent (10). Evidence also indicates a potential shift to endoparasitism when soil temperatures reach a certain threshold (26), which was not accounted for in this study. Lance nematode populations steadily rose throughout the year, and a reduction in lance nematodes in midsummer following root decline was not observed in this study. Lance nematode populations in Indiana in 2022 peaked significantly in August, when soil temperatures most likely are not conducive for creeping bentgrass root development and subsequent increases in lance nematode populations.
On average, root-knot nematode populations were below the threshold in which turfgrass managers are recommended to apply a nematicide (37). Significantly more root-knot populations were found in MO/KC at the 0–5 cm depth, and it is widely reported that these species tend to aggregate at this depth. The presence of significantly more root-knot nematodes in April agrees with an early-year population density described by Barker (2) but contrasts with populations recorded by Sasser (25). In his study, Barker indicates moisture levels were high enough in January to induce egg hatch in root-knot populations in February, so populations recorded then would be higher, followed by a reduction as competition for food increases. Sasser observed population peaks in November, but indicated this population fluctuation may be specific to the host crop. Additionally, Sasser sampled only during the months of February, May and November of one year, and March of the following year. The time gaps between these selected sampling months could be a time in which
Populations of ring nematodes shared a depth-by-month interaction, but the month in which the most ring nematodes were found in the 0–5 cm range differed between MO/KC and Indiana. While ring populations peaked in August and October in Indiana and MO/KC, respectively, Davis (6) reported ring nematode populations on a mixed bentgrass/bluegrass green in Chicago peaked in June. Davis was able to analyze populations of ring nematodes at the same sampling site through two years and found their populations did not peak in the same month two years in a row. However, Davis noted that trends did not agree year over year, and populations analyzed during the same year on two different greens within the same golf course changed together. Wick (33) observed populations on the same green did not change synchronously, and thus discredits evidence that population dynamics may be extrapolated across greens on the same course.
The disagreement of this study with other similar research indicates attempting to predict PPN populations based solely upon time of the year may be ineffective. In addition, Settle (26) describes the spatial aggregation of PPN communities across a putting green may vastly change the populations observed. Because of this, efforts to predict overall PPN populations within a green may be ineffective with current sampling methods, as one area of the putting green may contain significantly more PPNs than an area just a few meters away. The results of this study indicate a spring nematicide application would lower the PPN's ability to increase their populations throughout the summer, dependent on the nematicides ability to remain undegraded and maintain residual efficacy. However, differences in the half-life of common nematicides, e.g., the relatively short half-life of abamectin compared to longer half-life of fluopyram, is an important consideration when deciding which chemistry to employ (23,35). The presence of significantly more lance and ring nematodes in MO/KC found at 0–5 cm during October in this study indicates an additional early fall nematicide application date may be necessary to suppress these population peaks and potentially reduce these populations the following year. If turfgrass damage in Indiana can be accurately correlated to high lance nematode populations, a late season nematicide application may be more effective in controlling lance populations the following year. However, to target and control other PPNs throughout the summer season, an early spring application may be more effective.
With ITS sequence data as sole evidence of speciation, this is the first report of
This study reiterates literature on