Accès libre

Detection of DNA Microsatellites Using Multiplex Polymerase Chain Reaction Aboard the International Space Station

Sophia Chen

Sophia Chen

Lakeside High SchoolSeattle, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Chen, Sophia
, 
John Hatch

John Hatch

Harvard UniversityCambridge, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Hatch, John
, 
Ashley Luck

Ashley Luck

New England BiolabsIpswich, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Luck, Ashley
, 
Nicole M. Nichols

Nicole M. Nichols

New England BiolabsIpswich, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Nichols, Nicole M.
, 
Emily J. Gleason

Emily J. Gleason

miniPCR bioCambridge, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Gleason, Emily J.
, 
Kathryn Martin

Kathryn Martin

miniPCR bioCambridge, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Martin, Kathryn
, 
Kevin D. Foley

Kevin D. Foley

BoeingHouston, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Foley, Kevin D.
, 
D. Scott Copeland

D. Scott Copeland

BoeingHouston, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Scott Copeland, D.
, 
Sebastian Kraves

Sebastian Kraves

miniPCR bioCambridge, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Kraves, Sebastian
 et 
Ezequiel Alvarez Saavedra

Ezequiel Alvarez Saavedra

miniPCR bioCambridge, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Saavedra, Ezequiel Alvarez
  
31 déc. 2021
Detection of DNA Microsatellites Using Multiplex Polymerase Chain Reaction Aboard the International Space Station's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Télécharger la couverture
Catégorie d'article: Research Note
Publié en ligne: 31 déc. 2021
Pages: 164 - 170
DOI: https://doi.org/10.2478/gsr-2021-0013
Mots clés
© 2021 Sophia Chen et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

Experimental approach and gel electrophoresis results. (A) PCR samples were prepared on the ground and frozen at −80°C prior to launch to ISS. PCR took place aboard the ISS and amplified samples were frozen at −80°C for return to Earth. Electrophoresis was carried out on the ground. (B) Gel electrophoresis image of PCR products. NR-27, NR-21, NIR-24, BAT-25, and BAT-26 are the five microsatellites. MSS and MSI indicate the source of template DNA. Samples were amplified either on the ground (G) or in space (S).
Experimental approach and gel electrophoresis results. (A) PCR samples were prepared on the ground and frozen at −80°C prior to launch to ISS. PCR took place aboard the ISS and amplified samples were frozen at −80°C for return to Earth. Electrophoresis was carried out on the ground. (B) Gel electrophoresis image of PCR products. NR-27, NR-21, NIR-24, BAT-25, and BAT-26 are the five microsatellites. MSS and MSI indicate the source of template DNA. Samples were amplified either on the ground (G) or in space (S).

Figure 2

Determination of microsatellite sizes of pentaplex reactions by capillary electrophoresis. Capillary electrophoresis traces of pentaplex amplification reactions from either MSI or MSS samples performed either on the ground or in space show amplification of all five target sequences (NR-27, FAM channel, blue; NR-21, PET channel, red; NR-24, VIC channel, green; BAT-25, FAM channel, blue; BAT-26, PET channel, red).
Determination of microsatellite sizes of pentaplex reactions by capillary electrophoresis. Capillary electrophoresis traces of pentaplex amplification reactions from either MSI or MSS samples performed either on the ground or in space show amplification of all five target sequences (NR-27, FAM channel, blue; NR-21, PET channel, red; NR-24, VIC channel, green; BAT-25, FAM channel, blue; BAT-26, PET channel, red).

Amplicon size comparison for single and pentaplex PCR_

NR-27 NR-21 NR-24 BAT-25 BAT-26
Penta Single Penta Single Penta Single Penta Single Penta Single
Ground MSI 74.7 73.6 102.6 102.8 115.8 115.9 141.7 141.7 168.4 168.9
Space MSI 73.9 73.9 102.1 102.1 115.5 115.8 141.6 141.6 168.3 168.2
Ground MSS 84.6 84.6 107.2 108.0 122.4 122.4 145.5 145.4 180.7 180.6
Space MSS 84.5 84.5 107.2 107.2 122.4 122.3 145.4 144.5 180.6 180.5

Amplification reactions run on the ISS_

Reaction 1 DNA Primers
1 MSS Pentaplex: NR-27, NR-21, NR-24, BAT-25, BAT-26
2 MSI Pentaplex: NR-27, NR-21, NR-24, BAT-25, BAT-26
3 MSS NR-27
4 MSI NR-27
5 MSS NR-21
6 MSI NR-21
7 MSS NR-24
8 MSI NR-24

Microsatellite markers targeted in this investigation_

Microsatellite marker Primer sequences Fluorescent label Expected size MSS (bp) Expected size MSI (bp)
NR-27 AACCATGCTTGCAAACCACTCGATAATACTAGCAATGACC FAM 90 87
NR-21 GAGTCGCTGGCACAGTTCTACTGGTCACTCGCGTTTACAA HEX 110 107
NR-24 GCTGAATTTTACCTCCTGACATTGTGCCATTGCATTCCAA NED 129 126
BAT-25 TACCAGGTGGCAAAGGGCATCTGCATTTTAACTATGGCTC FAM 152 148
BAT-26 CTGCGGTAATCAAGTTTTTAG AACCATTCAACATTTTTAACCC HEX 182 179
Langue:
Anglais
Périodicité:
2 fois par an
Sujets de la revue:
Sciences de la vie, Sciences de la vie, autres, Sciences des matériaux, Sciences des matériaux, autres, Physique, Physique, autres
RSS Feed de la revue