Accès libre

The role of exogenous glutamine on germination, plant development and transcriptional expression of some stress-related genes in onion under salt stress

Kamile Ulukapi
Kamile Ulukapi
 et 
Ayse Gul Nasircilar
Ayse Gul Nasircilar
   | 22 févr. 2024
Folia Horticulturae's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Article Category: ORIGINAL ARTICLE
Publié en ligne: 22 févr. 2024
Pages: -
Reçu: 23 oct. 2023
Accepté: 09 janv. 2024
DOI: https://doi.org/10.2478/fhort-2024-0002
Mots clés
© 2024 Kamile Ulukapi et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1.

Changes in GP, MGT, CVG, and GI caused by salt stress and Gln treatments. Statistically significant differences between treatments are shown in the bar graphs with different letters. According to one-way ANOVA (Tukey test), statistically significant differences were determined between the experimental groups at the p ≤ 0.05 level. ANOVA, analysis of variance; CVG, coefficient of velocity of germination; GI, germination index; GP, germination percentage; MGT, mean germination time.
Changes in GP, MGT, CVG, and GI caused by salt stress and Gln treatments. Statistically significant differences between treatments are shown in the bar graphs with different letters. According to one-way ANOVA (Tukey test), statistically significant differences were determined between the experimental groups at the p ≤ 0.05 level. ANOVA, analysis of variance; CVG, coefficient of velocity of germination; GI, germination index; GP, germination percentage; MGT, mean germination time.

Figure 2.

Linear projection of the distribution of applications according to plant growth and germination values and visualisation of the classification of applications according to the change in plant characteristics with heat map. (A) Linear projection according to germination attributes, (B) linear projection according to germination and vegetative attributes (C) heat map. By using the principal component analysis data in linear projection (A and B), a two-dimensional projection is presented in which different applications are best separated according to variables. As it can be followed from the scale on the heat map (C), the change of colours gives information about the effect of the applications on the variables. The lowest values are shown in dark blue. The change of colour towards white in the heat map showed that the values increased.
Linear projection of the distribution of applications according to plant growth and germination values and visualisation of the classification of applications according to the change in plant characteristics with heat map. (A) Linear projection according to germination attributes, (B) linear projection according to germination and vegetative attributes (C) heat map. By using the principal component analysis data in linear projection (A and B), a two-dimensional projection is presented in which different applications are best separated according to variables. As it can be followed from the scale on the heat map (C), the change of colours gives information about the effect of the applications on the variables. The lowest values are shown in dark blue. The change of colour towards white in the heat map showed that the values increased.

Figure 3.

Total Chl, Chl a, Chl b, Chl a/b and carotenoid amounts determined in leaf tissues of control and experimental groups of onion. Data are given as mean ± standard deviation, n = 5. The averages shown with different letters on the graph are statistically different from each other. One-way ANOVA, TUKEY HSD test, p ≤ 0.05 (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln,11: 150 mM NaCl + 2 mM Gln, 12: 150 mM NaCl + 3 mM Gln, 13: 150 mM NaCl + 4 mM Gln). ANOVA, analysis of variance; Chl a, chlorophyll a; Chl a/b, chlorophyll a/b ratio; Chl b, chlorophyll b; total Chl, total chlorophyll.
Total Chl, Chl a, Chl b, Chl a/b and carotenoid amounts determined in leaf tissues of control and experimental groups of onion. Data are given as mean ± standard deviation, n = 5. The averages shown with different letters on the graph are statistically different from each other. One-way ANOVA, TUKEY HSD test, p ≤ 0.05 (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln,11: 150 mM NaCl + 2 mM Gln, 12: 150 mM NaCl + 3 mM Gln, 13: 150 mM NaCl + 4 mM Gln). ANOVA, analysis of variance; Chl a, chlorophyll a; Chl a/b, chlorophyll a/b ratio; Chl b, chlorophyll b; total Chl, total chlorophyll.

Figure 4.

Gel image of the primers included in the analysis. (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln, 11: 150 mM NaCl + 2 mM Gln, 12: 150 mM NaCl + 3 mM Gln, 13: 150 mM NaCl + 4 mM Gln). L (Ladder): Fermantas zip ruler DNA ladder 100 bp.
Gel image of the primers included in the analysis. (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln, 11: 150 mM NaCl + 2 mM Gln, 12: 150 mM NaCl + 3 mM Gln, 13: 150 mM NaCl + 4 mM Gln). L (Ladder): Fermantas zip ruler DNA ladder 100 bp.

Figure 5.

GTS in the control and treatment groups. n = 8, data mean ± standard error. Comparison of treatment groups compared to control, data are statistically different, one-way ANOVA test, *p ≤ 0.05, **p ≤ 0.01; #comparative applications vs. 150 mM NaCl, data are statistically different, independent groups t-test, p ≤ 0.05 (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln,11: 150 mM NaCl + 2 mM Gln,12: 150 mM NaCl + 3mM Gln, 13: 150 mM NaCl + 4mM Gln). ANOVA, analysis of variance; GTS, genomic template stability.
GTS in the control and treatment groups. n = 8, data mean ± standard error. Comparison of treatment groups compared to control, data are statistically different, one-way ANOVA test, *p ≤ 0.05, **p ≤ 0.01; #comparative applications vs. 150 mM NaCl, data are statistically different, independent groups t-test, p ≤ 0.05 (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln,11: 150 mM NaCl + 2 mM Gln,12: 150 mM NaCl + 3mM Gln, 13: 150 mM NaCl + 4mM Gln). ANOVA, analysis of variance; GTS, genomic template stability.

Figure 6.

Relative fold increased values of antioxidant defence genes CuZn-SOD, Mn-SOD, AOX, DNA damage repair gene PLOD1, heat-shock molecular chaperone CHAPE and HSP21 gene expressions in leaf tissues in experimental groups (data are β-actin and normalised to 18S mRNA level by the multiple control method). Data are given as mean ± standard error, n = 5. The averages shown with different letters on the graph are statistically different from each other. One-way ANOVA, Tukey HSD test, p ≤ 0.05 (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln,11: 150 mM NaCl + 2 mM Gln,12: 150 mM NaCl + 3mM Gln, 13: 150 mM NaCl + 4 mM Gln). ANOVA, analysis of variance.
Relative fold increased values of antioxidant defence genes CuZn-SOD, Mn-SOD, AOX, DNA damage repair gene PLOD1, heat-shock molecular chaperone CHAPE and HSP21 gene expressions in leaf tissues in experimental groups (data are β-actin and normalised to 18S mRNA level by the multiple control method). Data are given as mean ± standard error, n = 5. The averages shown with different letters on the graph are statistically different from each other. One-way ANOVA, Tukey HSD test, p ≤ 0.05 (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln,11: 150 mM NaCl + 2 mM Gln,12: 150 mM NaCl + 3mM Gln, 13: 150 mM NaCl + 4 mM Gln). ANOVA, analysis of variance.

Genes, gene names, sequences and literature.

Gene ID Gene name Primer sequences (5→3’) Reference
SOD Superoxide dismutase F TTCCTCCAGCATTCCCAGTG Ghodke et al. (2020)
R ATGGCTTGACACATGGTGCT
SOD-2 Superoxide dismutase 2, mitochondrial F GGCGAAGCAAACAGCCTCAT Ji et al. (2021)
R AGTATCGCCGAACGAGTGGA
AO L-ascorbate oxidase-like F TGATGTTTGTGCTGTCTTTCGG Ghodke et al. (2020)
R ACCGTGAAAGTGTTTGTGCT
POLD1 DNA Polymerase Delta 1, catalytic subunit F AGACGACTCGCTGTGTATTGCT Lyu et al. (2020)
R CCAGTAACTCGTGCCATCTCCA
Chape Chaperone F TCCTGGCAAGTCTGCTTTGA Ghodke et al. (2020)
R GGCTCTAATTCCTCGCGTTT
HSP21 21 kDa protein F TAGATGGATGGCGAACTCGG Ghodke et al. (2020)
R TCTTCTTCTTCGCACTCCT
β-Actin β-actin F TCCTAACCGAGCGAGGCTACAT Sun et al. (2013)
R GGAAAAGCACTTCTGGGCACC
18S 18S ribosomal RNA F GAATGACTCCTGGCAATG Liu et al. (2015)
R GATTGGAATGACGCTATACA

Changes in the vegetative growth of onions at different Gln concentrations under salt-stress and non-stress conditions.

Treatments SL (mm) RL (mm) SFW (g) RFW (g) SDW (g) RDW (g) TLN (no.)
Control 300.78 ab 335.30 a 4.7717 bc 5.3486 a 0.2974 b 0.2578 b 5.4 c
50 mM NaCl 200.50 abc 174.67 b 3.3849 c 1.8111 bcd 0.2423 b 0.1269 cd 6.0 c
100 mM NaCl 176.14 bcd 99.98 bcd 3.0034 c 0.9761 cd 0.3421 b 0.0514 de 4.7 c
150 mM NaCl 55.37 de 54.16 cd 1.6138 c 0.7861 cd 0.1272 b 0.0980 de 4.3 c
200 mM NaCl 35.96 e 30.95 d 0.6784 c 0.2976 d 0.1009 b 0.0250 e 3.6 c
1 mM Gln 265.67 ab 78.67 bcd 5.6750 abc 2.0207 bcd 0.3935 b 0.1229 cd 6.7 bc
2 mM Gln 316.00 a 131.33 bc 11.1293 a 3.1972 b 5.0274 a 0.2022 bc 11.6 ab
3 mM Gln 269.00 ab 70.00 cd 10.4772 ab 2.8864 bc 3.4157 a 0.9267 a 13.7 a
4 mM Gln 243.67 ab 68.67 cd 6.4551 abc 2.2977 bcd 4.5882 a 0.2567 b 6.6 bc
150 mM NaCl+ 1 mM Gln 64.67 de 79.67 bcd 1.3471 c 1.8282 bcd 0.1246 b 0.1017 de 3.7 c
150 mM NaCl+ 2 mM Gln 65.33 de 78.00 cd 1.6087 c 1.3310 bcd 0.1228 b 0.1293 cd 6.0 c
150 mM NaCl+ 3 mM Gln 81.67 cde 84.67 bcd 1.7282 c 1.8951 bcd 0.1594 b 0.1341 cd 6.6 bc
150 mM NaCl+ 4 mM Gln 77.67 cde 64.00 cd 0.8713 c 1.1304 bcd 0.1030 b 0.1166 cde 5.7 c
** ** ** ** ** ** **

Schematic representation of the experiment.

Treatments
First stage Control 50 mM NaCl 100 mM NaCl 150 mM NaCl 200 mM NaCl 1 mM Gln 2 mM Gln 3 mM Gln 4 mM Gln
Second stage 150 mM NaCl + 1 mM Gln 150 mM NaCl + 2 mM Gln 150 mM NaCl + 3 mM Gln 150 mM NaCl + 4 mM Gln

RAPD PCR primers and sequences.

Primer Primer sequence
RAPD2 5′ ACGGTACCAG 3′
RAPD7 5′ TTCCGAACCC 3′
OPPO5 5′ CCCCGGTAAC 3′
OPI18 5′ TGCCCAGCCT 3′
12OPC06 5′ GAACGGACTC 3′
14OPC09 5′ CTCACCGTCC 3′
19OPC14 5′ TGCGTGCTTG 3′
21OPC16 5′ CACACTCCAG 3′
OPW10 5′ TCGCATCCCT 3′
30OPAF05 5′ CCCGATCAGA 3′
25OPN01 5′ CTCACGTTGG 3′
S237 5′ ACCGGCTTGT 3′
eISSN:
2083-5965
Langue:
Anglais
Périodicité:
2 fois par an
Sujets de la revue:
Life Sciences, Plant Science, Zoology, Ecology, other
RSS Feed de la revue