À propos de cet article

Citez

Interindividual variability in drug response can lead to alteration of the therapeutic effect, which includes lacking drug efficacy or drug toxicity. The human cytochrome P450 (CYP450) enzyme superfamily is responsible for the oxidative metabolism of many drugs, xenobiotics, as well as other endogenous substrates. Inherited genetic variations in CYP450 genes are well known as factors contributing to the difference in drug response among individuals. In recent years, the increase in genetic tests allowed detection of large numbers of human genetic variants. Despite single nucleotide polymorphisms (SNPs) of CYP450 that were intensively studied among various populations worldwide, there is little information available about the copy number variations (CNVs) of these pharmacogenes.

CNV is a type of structural variation defined as duplications or deletions of DNA fragments ranging from 1 kb to 3 Mb, in which the number of copies of a particular gene differs from one individual to another. The completion of the Human Genome Project had made it clear that many genetic regions in the human genome experience gains and losses of genetic materials, which carry more or less than 2 copies. Until now, alleles that consisted of 0–13 gene copies had been described across the human population globally. Pharmacogenetic CNV alleles could play an important role in enzyme activity as well as drug response diversity. In fact, several works have described CNVs in pharmacogenes such as CYP2B6, CYP2D6, GSTT1, GSTM1, SULTA1 and SULTA2 [1,2,3]. In 2018, available CNVs data were investigated and revealed that several populations harbor CNV alleles at CYP2C gene locus, in which CYP2C19 showed the highest number of novel deletions [4]. Recently, a report on 340 genes involved in absorption, distribution, metabolism, and excretion of drugs had identified 445 deletions and 167 duplications in 36 pharmacogenes, including the well-known CNVs of CYP450 (CYP2D6, CYP2A6) [5].

The CNV data of CYP450 and other pharmacogenes across populations still remain limited while the CNV profile of these genes in Vietnam had not been reported yet. Therefore, this study aimed to determine the prevalence of CYP450 CNVs in Vietnamese Kinh—the largest ethnic group accounting for approximately 86% of the whole population. For copy number detection, multiplex ligation-dependent probe amplification (MLPA) was used and subsequently, quantitative PCR (qPCR) copy number assays or genotyping was performed to validate the observed CNVs. This study would provide new insights into CYP450 CNVs frequency in a Vietnamese Kinh cohort, which extends the understanding of these CNVs in Asia and the potential application of data in translation of pharmacogenetics from the bench to bedside.

Materials and methods
Study subjects and DNA extraction

A total of 154 unrelated healthy Kinh volunteers (93 females and 61 males) from Hanoi Medical University of Vietnam were recruited. All subjects were regarded as healthy according to their medical history and physical examination. The ethnic identity of volunteers was identified based on their personal documents with at least 3 generation of corresponding parental ancestry. The study purpose was explained to all individuals and written informed consent was obtained from each subject before sample collection. This project was approved by the Institutional Review Board (IRB) of the Institute of Genome Research, Vietnam Academy of Science and Technology. The study is in accordance with the STROBE statement [6]. For all subjects, 2 mL of peripheral blood was collected and preserved in EDTA containing tubes. Genomic DNA was subsequently extracted from the blood samples using E.Z.N.A Blood DNA Mini Kit (USA) according to manufacturer's instructions.

Multiplex ligation-dependent probe amplification

To identify deletions/duplications on CYP450 gene, MPLA was performed using the commercial SALSA MLPA P128-C1 Cytochrome P450 Probemix kit (MRC-Holland, Amsterdam, Netherlands) following the manufacturer's instructions. The CNVs data of CYP2D6 detected in these 154 subjects were separately reported [7]. In addition to CYP2D6, MLPA probemixs were specifically designed for 2–6 exons of other CYP450 genes, including CYP1A1, CYP1A2, CYP1B1, CYP2A6, CYP2B6, CYP2C9, CYP2C19, CYP2E1, CYP3A4, and CYP3A5. Fifty nanograms of genomic DNA was denatured at 98°C for 5 min and cooled at 25°C. Denatured DNA were later hybridized with SALSA probemix at 60°C for 16–20 h. Subsequently, the annealed probes were ligated at 54°C for 15 min followed by heating at 98°C in 5 min. In the next step, complete ligation reactions were used for the PCR with thermocycle consisting of 35 cycles (95°C for 30 s, 60°C for 30 s and 72°C for 60 s), followed by incubation at 72°C for 20 min. The amplicons were separated by capillary gel electrophoresis and the collected data were analyzed using the Coffalyzer.net software. The copy number of subjects was determined by the final probe ratio distribution: 0 copy (0), 1 copy (0.4–0.65), 2 copies (0.8–1.2), 3 copies (1.3–1.65), and 4 copies (1.75–2.15).

Copy number analyses of CYP1B1, CYP2C9, and CYP2E1 by qPCR

Gene dosage of different samples was performed with relative quantification real-time PCR method. Real-time PCR reaction was performed using Luna Universal qPCR Master Mix (NEB) and RPPH1 (a reference gene with a single copy) primers used for quantitative analysis were referred to Ahani's study [8]. Additionally, primers were designed for specific detection of CYP1B1 (exons 1 and 2), CYP2E1 (exons 8 and 9) and CYP2C9 (exons 4 and 7) (Table 1). The reaction was performed in 96 wells plate with 10 μL volume in total, which included 10 ng genomic DNA, 1X Luna Universal qPCR Mastermix (NEB), 0.25 μL for each primer (10 pmole/μL) and Ultrapure Distilled Water (ThermoFisher Scientific). Subsequently, the covered plates were run on LightCycler 96 Instrument (Roche) with the thermocycle with denaturation at 95°C for 10 min, following by 45 cycles (95°C for 15 s and 60°C for 60 s). The copy number of targeted exon in comparison to reference gene was determined according to the following equation: ΔΔCt = [CtRPPH1(Reference sample) − Ct targeted exon (reference sample)] − [CtRPPH1(Unknown sample) − Ct targeted exon (Unknown sample)]. The relative copy number of the genes was later calculated following the ratio equation (2−ΔΔCt).

Primers sequence for real-time PCR detecting copy number of CYP1B1, CYP2C9, and CYP2E1

Gene-region Primer name Sequence (5′-3′)
CYP1B1 Exon 1 CYP1B1 E1F CTG CGACTCCAGTTGTGAGAG C
CYP1B1 E1R AGTCTCTTGGCGTCG TCAGTG
CYP1B1 Exon 2 CYP1B1 E2F CACAGCATGATGCGCAACTTC
CYP1B1 E2R CACTCATGACGTTGGCCA CG
CYP2C9 Exon 4 CYP2C9 E4F ATGCATGCCGAACTCTTTTT
CYP2C9 E4R2 AGGATGAAAGTGGGATCACAGG
CYP2C9 Exon 7 CYP2C9 E7F CACATTTGTGCATCTGTAACCA
CYP2C9 E7R3 CCGGTTTCTGCCAATCACACG
CYP2E1 Exon 8 CYP2E1 E8F GGCACAGTCGTAGTGCCAACTC
CYP2E1 E8R CTGCCTCTGATCTTTCTCACCTG
CYP2E1 Exon 9 CYP2E1 E9F TGGAGAAGGCCTGGCTCGCATG
CYP2E1 E9R GTTCAGGGTGTCCTCCACACAC
CYP2A6 genotyping

Five primers were used in 2-step PCR method in order to detect CYP2A6 deletion allele as previously described by Oscarson et al. [9] (Table 2). Eight microliters of PCR II were aliquoted and subsequently analyzed on 1% agarose gel staining with ethidium bromide.

Primer used for genotyping the CYP2A6 deletion and duplication alleles [9]

Primer name Sequence (5′-3′)
2A E7F GRC CAA CAT GCC CTA CAT G
2A6R1 GCA CTT ATG TTT TGT GAG ACA TCA GAG ACA A
2A6E8F CAC TTC CTG AAT GAG
2A7E8F CAT TTC CTG GAT GAC
2A6R2 AAA ATG GGC ATG AAC GCC C
Statistical analysis

Inter-ethnic comparison of genes copy number frequency between Kinh Vietnamese and global populations were assessed by Chi square (c2) and Fisher exact test. All statistical analyses were 2-sided and P < 0.05 was considered as statistically significant.

Results
Copy number profiling of CYP450 genes in Vietnamese Kinh

CNVs of CYP450 genes were analyzed using MLPA with probes designed for 10 following genes except CYP2D6: CYP1A1, CYP1A2, CYP1B1, CYP2A6, CYP2B6, CYP2C9, CYP2C19, CYP2D6, CYP2E1, CYP3A4, and CYP3A5. Among 154 unrelated healthy individuals, CNVs were detected in only 4 genes including CYP1B1, CYP2A6, CYP2C9 and CYP2E1. Of these genes, deletions were identified in CYP2A6 and CYP2C9, duplications were found in CYP1B1, and only CYP2E1 with both duplications and deletions was identified. The representative MLPA data from samples harboring variable copy numbers are shown in Table 3. Additionally, the detail of CYP450 CNVs observed in studied subjects are shown in Figure 1.

Final probe ratio from MLPA of representative samples carrying CYP450 copy number alterations

Samples CYP1B1 CYP2A6 CYP2C9 CYP2E1




Exon 2 Exon 3 Exon 1 Exon 2 Exon 3 Exon 5 Exon 1 Exon 7 Exon 8-1 Exon 8-2 Exon 9 Exon 5 Exon 6 Exon 8
FVN48 0.89 0.87 0.41 0.42 0.5 0.43 1.1 1.18 1.16 1.06 0.92 0.95 0.93 0.88
FVN74 0.89 0.85 0 0 0 0 1 1 1 0.96 0.99 1.02 0.94 1.11
MVN23 1.34 1.53 1.15 1.14 1.16 1.15 0.47 0.55 0.61 0.56 0.58 1.09 1.08 0.99
FVN73 1.08 0.99 1.05 1.07 1.04 1.08 1 0.99 0.98 0.92 0.96 0.51 0.51 0.47
FVN46 1.04 1.1 0.94 0.92 1.17 1.2 1.17 1.03 1.1 0.82 0.93 1.37 1.38 1.63
FVN98 0.86 0.86 0.97 0.98 1.16 0.91 1.06 0.96 1.02 1.28 1.11 1.36 1.37 1.37

Final probes ratio indicated deletions (underline); final probes ratio indicated duplications (bold).

MLPA, multiplex ligation-dependent probe amplification.

Figure 1.

Graphical illustration of CYP450 CNVs identified in current study. (A) Reference gen locus of CYP1B1 (up) and CYP1B1Dup allele (down). CYP1B1 located on chromosome 2 and represented by yellow boxes. (B) Reference gen locus on chromosome 19 of CYP2A6 (orange box) and pseudogene CYP2A7 (grey box) (up) and CYP2A6Del allele (down), downstream of exon 9 of CYP2A6 is denoted by the black boxes. Primers position and strategy used for CYP2A6 del allele detection are also shown. (C) Reference gene cluster on chromosome 10 including CYP2C9 (blue box), CYP2C8 (green box) (up), and CYP2C9 Del allele (down). (D) Reference gen locus of CYP2E1 (pink box) on chromosome 10 (up), CYP2E1Del allele (middle), and CYP2E1Dup allele with 2 copies of the gene (down). CNVs, copy number variations.

Identification of CYP1B1, CYP2A6, CYP2C9, and CYP2E1 CNVs

For CYP2A6, both homozygous and heterozygous deletions were detected in the studied subjects by MLPA with copy number probes designed for exons 1, 2, 3, and 5. Among 154 subjects, the most frequent genotype was Wt/Wt having 2 copies (80.52%), following by Wt/Del genotype having 1 copy (16,88%). The homozygous deletion of CYP2A6 with Del/Del genotype having 0 copy made up only 2.6% (Table 4). The frequency of CYP2A6 alleles ranged from 11% (CYP2A-6Del-0 copy) to 89% (CYP2A6Wt-1 copy) (Table 5). CYP2A6 duplication alleles (2 copies) were not identified in this study. Samples showing deletion alleles of CYP2A6 were randomly chosen for re-genotyping in order to confirm the MLPA results. The genotyping results were consistent with MLPA and indicated that deletions found in the studied subjects encompassed the entire CYP2A6 gene (Figure 2).

Genotypes frequency of CYP450 copy number variability

Genotype Gene/genotypes frequency

CYP1B1 CYP2A6 CYP2C9 CYP2E1




N Freq. (%) N Freq. (%) N Freq. (%) N Freq. (%)
Wt/Del 0 0 26/154 16.88 3/154 1.95 1/154 0.65
Del/Del 0 0.00 4/154 2.60 0 0.00 0 0.00
Wt/Dup 3/154 1.95 0/154 0.00 0 0.00 3/154 1.95
Wt/Wt 151/154 98.05 124/154 80.52 151/154 98.05 150/54 97.40

Alleles frequency of CYP450 copy number variability

Allele/copies Gene/alleles frequency (n = 308)

CYP1B1 CYP2A6 CYP2C9 CYP2E1




Freq. 95% CI Freq. 95% CI Freq. 95% CI Freq. 95% CI
Dup (2) 0.010 0.000–0.010 - - - - 0.010 0.000–0.021
Wt (1) 0.990 0.980–1.000 0.890 0.852–0.927 0.990 0.980–1.000 0.987 0.974–1.000
Del (0) - - 0.110 0.073–0.148 0.010 0.000–0.021 0.003 0.000–0.010

CI, confidence interval; n, number of alleles.

Figure 2.

Copy number confirmation of CYP2A6Del. (A) Amplification of a part of CYP2A6 gene or hybrid CYP2A7/2A6 using primer pair 2AE7F/2A6R1 resulting in approximately 2 kb products. (B) Detection of CYP2A6Del allele, Wt: Wild-type allele, Del: Deletion allele. CYP2A6 genotype of tested samples were as follows: FVN48: Wt/Del, FVN74: Del/Del, FVN79: Wt/Wt.

For CYP1B1, MLPA data resulted in duplications in studied subjects with copy number probes specific for exons 1 and 3. Of 154 subjects, the homozygous wildtype was the most common genotype (98.05%). Meanwhile, heterozygous duplication of CYP1B1 (Wt/Dup) made up only 1.95% (Table 4). There were 2 CYP1B1 alleles identified with frequencies ranging from 1% (Dup-2 copies) to 99% (Wt-1 copy) (Table 5). Two real-time PCR assays were subsequently used in order to confirm the MLPA results with primers located in exon 1 and exon 2 of CYP1B1. The results of qPCR were 100% in agreement with those of MLPA data obtained (Figure 3A). Furthermore, no CYP1B1 deletion alleles were detected among the studied subjects.

Figure 3.

Copy number confirmation of CYP1B1, CYP2C9, and CYP2E1. Primers for real-time PCR located in exon 1 and exon 2 of CYP1B1, exons 4 and 7 of CYP2C9, exons 8 and 9 of CYP2E1 were used to confirm CNVs detected by MLPA in these genes. REF: reference samples, in which MLPA showing 2 copies of gene of interest. (A) Heterozygous duplications of CYP1B1 detected in both FVN 96 and MVN 21. (B) Heterozygous deletions of CYP2C9 were found in both MVN 21 and MVN 23. (C) Copy number confirmation of CYP2E1 showed that heterozygous deletion was detected in FVN 73 while heterozygous duplications were identified in FVN 46, FVN 98, Kinh 712 and DB98. CNVs, copy number variations; MLPA, multiplex ligation-dependent probe amplification.

For CYP2C9, heterozygous deletion was detected in studied subjects by MLPA with copy number probes designed for exons 1, 7, 8(1), 8(2), and 9. In total of 154 subjects, 2 genotypes were observed with frequencies that varied from 1.95% (Wt/Del) to 98.05% (Wt/Wt) (Table 4). Two identified CYP2C9 alleles were Wt (1 copy) and Del (0 copy) accounting for 99% and 1%, respectively (Table 5). Two real-time PCR assays were used to confirm the MLPA results with primers located in exon 4 and exon 7 of CYP2C9. Both exons 4 and 7 of the gene showed the loss of CYP2C9 copy number, indicating the accuracy of MLPA (Figure 3B). Additionally, CYP2C9 duplication alleles were not determined in this study.

For CYP2E1, heterozygous duplications were detected in 3/154 subjects (1.95%) by MLPA with copy number probes designed for exons 5, 6, and 8. Additionally, heterozygous deletions were found in only 1/154 subjects (0.65%) (Table 4). Three observed CYP2E1 alleles consisted of Dup (2 copies), Wt (1 copy) and Del (0 copy), which made up 1%, 98.7%, and 0.3%, respectively (Table 5). Two real-time PCR assays were applied in order to verify the MLPA results using primers located in exon 8 and exon 9. Both exons of CYP2E1 showed the gain of copy number in 2 samples tested compared with reference sample. The loss of CYP2E1 copy number in tested samples was also in agreement with the data observed in MLPA (Figure 3C). Besides, no CYP2E1 deletion carriers were identified in this study.

Comparison of CYP450 CNVs between Vietnamese Kinh and global populations

We further compared the CNVs observed in CYP2A6 and CYP2E1 between Kinh Vietnamese and populations from different geographical areas in the world (Table 6). For CYP2A6, no significant difference in CYP2A6Dup allele (0%) was observed between the present study and other populations, except for Ashkenazi Jews (P < 0.05). In Kinh Vietnamese, frequency of CYP2A6Del was significantly higher than those found in other populations, including Asian. For CYP2E1, frequency of CYP2E1Dup was significantly lower compared with data observed in African-American and Hispanic. Both CYP2A6Wt and CYP2E1Wt allele frequency detected in the studied subjects were similar to those previously figured out in other populations.

Comparison of CYP450 CNVs frequency between Kinh Vietnamese and worldwide populations

Population N Alleles/copy number of CYP2A6 References

Dup (2) Wt (1) Del (0)
CYP2A6 copy number alleles frequency
Kinh Vietnamese 154 ND 0.89 0.11 Present study
Chinese 96 - 0.849 0.151 [9]
Finns 100 - 0.96 0.001***
Spaniards 100 - 0.965 0.005***
Korean 209 - 0.885 0.11 [10]
Japanese 92 - 0.799 0.201** [11]
African-American 105 0.01 0.952 0.038** [2]
Asian 102 0.015 0.902 0.083**
Caucasian 103 ND 0.985 0.015***
Hispanic 109 ND 0.986 0.014***
Ashkenazi Jews 123 0.02* 0.98 ND***
Colombian 123 0.004 0.976 0.02*** [12]
Population N Alleles/copy number of CYP2E1 References

Dup (2) Wt (1) Del (0)
CYP2E1 copy number alleles frequency
Kinh Vietnamese 154 0.01 0.987 0.003 Present study
African-American 105 0.038* 0.962 ND [2]
Asian 102 ND 1 ND
Caucasian 103 0.029 0.971 ND
Hispanic 109 0.041* 0.959 ND
Ashkenazi Jews 123 0.004 0.996 ND
Colombian 123 0.016 0.984 ND [12]

P < 0.05.

P < 0.01.

P < 0.001.

CNVs, copy number variations; N, number of subjects; ND, not detected.

Discussion

Of the 11 studied CYP450 genes, the gene with the highest CNV frequency observed was CYP2A6, including both duplication and deletion alleles. As previous works described, CYP2D6 together with CYP2A6 are genes encoded for Phase I drug metabolism enzyme, which displayed the greatest number of CNVs [2, 5]. The most well-known CNV genes among CYP450 are CYP2D6; the clinical impact of CNVs in this gene on a wide range of drugs have been reported in numerous studies. In fact, patients with duplicated CYP2D6 presented with low-serum concentration of paroxetine for depression treatment [13] or lower plasma concentration of donepezil while no clinical improvement observed in Alzheimer's treatment [14]. For using painkillers, CYP2D6 duplicated allele increase enzyme expression and activity, which is responsible for opioids poisoning [15]. At the moment of preparing the manuscript, CYP2D6 variants including the CNVs in Kinh Vietnamese were already published and we thereby further discuss other CYP450 genes.

In this study, CYP2A6Dup made up 1.16%, which is similar to that detected in the Asian and other populations in the world, except for Ashkenazi Jews. Notably, CYP2A-6Del was found at a much higher frequency (11%) in Kinh Vietnamese, which is also comparable with other populations in Asia such as the Chinese [9] and Korean [10]. Meanwhile, the Japanese showed a significantly higher prevalence of CYP2A6Del compared with the data of the current study [11]. An earlier research showed a significantly lower frequency of CYP2A6Del in Asians [2]. However, as the exact ethnic origins of the enrolled subjects were not mentioned in the study, this difference was possibly due to the selected subjects having come from various geographical areas in Asia [2]. Owing to the divergence of CYP2A6Dup and CYP2A6Del frequency in Asia, it has been suggested that different pressure of natural selection likely acted on certain allele [2]. Although deleterious variants usually underwent purifying selection [16], the high frequency of CYP2A6Del in Asia could be explained as the protective effect of this defective allele against lung and head and neck cancers in Asian populations [17]. CYP2A6 is well known as the primary metabolizing enzyme of nicotine, and in turn has an influence on smoking behavior. Furthermore, this enzyme also metabolizes several clinically relevant substrates, of which some of the most relevant are coumarin, tegafur, letrozole, valproic acid, and pilocarpine. Most studies assess the clinical impact of CYP2A6Del on the metabolism of these substrates, yet the obtained results were still limited. For tegafur, a finding in Japanese cancer patients indicated that individuals having CYP2A6Del allele could experience less exposure to the active metabolite of tegafur-5-fluorouracil [18]. Similarly, the in vitro formation of 5-fluorouracil in liver chromosomes was decreased in donors carrying CYP2A6Del compared with donors without this variant [21] [19]. On the contrary, it remains to be seen whether CYP2A6 variations have a significant effect on other substrates (valproic acid, pilocarpine), metabolism, as well as treatment outcome. There are currently no CYP2A6 CNVs included in the drug label approved by the FDA as well as guidelines from the Clinical Pharmacogenomics Implementation Consortium. Nevertheless, the common CYP2A6Del frequency in Kinh Vietnamese and other Asian populations should be taken into account.

For CYP1B1 and CYP2C9, little is known about the CNVs of these genes among different ethnic populations in the world. In this work, CYP1B1Dup and CYP2C9Del were both detected at only 1%. In 2019, a study analyzing CNVs of CYP450 in the Colombian population showed that CYP-2C9Del allele made up 0.4% while no CYP1B1Dup was observed in 123 studied subjects [12]. For CYP2E1, to our best knowledge, there were only 2 reports on CNVs of this gene, in which no CYP2E1Del was identified in Colombians as well as in representatives of 5 different populations (African-American, Asian, Caucasian, Hispanic and Ashkenazi Jews) [2, 12]. A recent work focusing on CYP2C locus structural variants from almost 100,000 individuals also identified low CNVs frequency of pharmacogenes [20]. Taken together, these data demonstrated that CNVs in other CYP450 genes are less common in all populations compared with CYP2A6 and CYP2D6. Until now, the Pharmacogene Variation Consortium (pharmvar.org) has reported a diverse number of variants of CYP1B1 (26 in total), CYP2C9 (62 in total), and CYP2E1 (7 in total) and most of these were SNPs and indels. Thereby, the impact of CNVs of pharmacogenes CYP1B1, CYP2C9, and CYP2E1 on drug response is possibly less significant than the SNPs of these genes. However, it should be noticed that individuals who carry CYP450 deletion/duplication could likely be at risk of insufficient drug response/drug toxicity due to poor metabolizer/ultra-rapid metabolizer phenotype. Although the translation of pharmacogenes CNVs into clinical intervention remains questionable, the clinical relevance of uncommon CNVs in these genes still should not be ignored.

In this study, 4 out of 10 of the studied genes showed the CNVs by MLPA technique. The accuracy of this method in identifying the genetic CNVs was confirmed by additional methods such as PCR and qPCR. However, the limitation of this study lies in lacking the evidence of breakpoint regions for each CNV detected in CYP1B1 (duplication), CYP2E1 (deletion and duplication), CYP2C9 (deletion), and CYP2A6 (deletion). This is due to the limited number of probes designed for only selected exonic regions of CYP450 genes. In fact, the structure of locus harboring CYP2E1 duplication or CY2A6 deletion was discovered. Currently, there are no reports on the exact junction regions of CYP1B1 duplication, CYP2C9 deletion, and CYP2E1 deletion. Depending on these junctions, whole exome sequencing or high-resolution method such as array Comparative Genomic Hybridization combined with Sanger sequencing might further resolve this hurdle of our research. Such worthy works would provide comprehensive evidence regarding the genetic architecture of pharmacogenes with structural variations.

Conclusion

This is a comprehensive study in Vietnam that describes the CNV profile of CYP450 genes in a cohort of the Kinh population. Alongside CYP2D6, our data further revealed the existence of CNVs in 4 genes including CYP1B1, CYP2A6, CYP2C9, and CYP2E1. This research supports the essential knowledge of CYP450 CNVs prevalence in Vietnam, whose possible impact on physical health as well as drug metabolism should be further clarified.

eISSN:
1875-855X
Langue:
Anglais
Périodicité:
6 fois par an
Sujets de la revue:
Medicine, Assistive Professions, Nursing, Basic Medical Science, other, Clinical Medicine