The genus
Currently, 77 valid
To date, among predaceous nematodes of the order Mononchida in Vietnam, 17
Soil samples were collected randomly from a pristine forest inthe Bat Xat Nature Reserve, Lao Cai Province, Vietnam. Nematodes were extracted from soil samples using modified Baermann funnel technique (Southey, 1986).
They were heat killed, fixed in 4% formaldehyde (for morphological observations) or in a DESS mixture (Yoder et al., 2006) (for molecular analyses), transferred to anhydrous glycerol (Seinhorst, 1962), and mounted on glass slides for microscopic observation. Measurements were performed with a Nikon digital camera on a Nikon Eclipse
Nematode DNA was extracted from a single individual as described by Holterman et al. (2006) and DNA extracts were stored at –20° until used as PCR template. The D2-D3 expansion segment 28S rDNA and 18S were amplified using the forward D2A (5′–ACAAGTACCGTGGGGAAAGTTG–3′) and reverse D3B (5′–TCGG AAGGAACCAGCTACTA–3′) primers (Subbotin et al., 2006) and primers 18S (18F : 5′-TCTAGAGCTAATAC ATGCAC-3′/18R: 5′-TACGGAAACCTTGTTACGAC-3′). All PCR reactions contained 12.5 μl Hot start green PCR Master Mix (2x) (Promega, USA), 1 μl of the forward and reverse primer (10 μM each), the 3 μl DNA template and sterile Milli-Q water to 25 μl of the total volume. All PCR reactions were performed in SimpliAmp Thermal cycler (Thermo Fisher Scientific) as follows: an initial denaturation step at 95°C for 4′min, followed by 40 cycles at 95°C for 30 sec, 54°C for 30 sec, and 72°C for 60 sec with a final incubation for 5 min at 72°C. Amplicons were visualised under UV illumination after Simplisafe gel staining and gel electrophoresis. Purified PCR products were sent to Apical Scientific Company for sequencing (Selangor, Malaysia). After sequencing the obtained
For phylogenetic relationships, analyses were based on 18S and 28S rDNA. The newly obtained rDNA sequences were analysed using the BioEdit sequences avalaible in GenBank using the ClustelW aligment tool implemented in the MEGA 7 version 7.0 (Kumar et al., 2016). The final 18S and 28S rDNA datasets for phylogenetic study included sequences from the current study
Holotype female
Paratype male
Holotype female
Paratype male
Morphometrics of females and Males of
Bat Xat Natural Reserve | |||
---|---|---|---|
Characters/ratios | Holotype | Paratypes | |
|
1 female | 4 females | 6 males |
|
3643 | 3768–5163 (4519 ± 585) | 2950-4230 (3487± 530) |
|
49.2 | 49.8-59.2 (56.3 ± 4.4) | 44.1-51.5 (48.9 ± 2.8) |
b | 4.8 | 4.9-5.4 (5.1 ± 0.2) | 4.7-5.4 (5.0 ± 0.3) |
c | 6.4 | 4.5-6.3 (5.6 ± 0.8) | 5.3-5.9 (5.6 ± 0.2) |
c′ | 12.2 | 14.4-19.0 (15.7 ± 2.2) | 8.2-13.1 (10.4 ± 1.7) |
V (%) | 58.3 | 54.2-59.4 (55.9 ± 2.4) | – |
Lip region height | 16.5 | 18.0-21.0 (19.8 ± 1.5) | 14.5-17.5 (16.3 ± 1.1) |
Lip region width | 50.0 | 52.5-70 (59.5 ± 7.5) | 46-52 (48.3 ± 2.7) |
Buccal cavity length | 73 | 69.5-88.5 (79.6 ± 8.9 | 61.5-67.2 (64.1 ± 2.2) |
Buccal cavity width | 41.5 | 41.0-54.0 (46.9 ± 6.1) | 36.0-41 (37.9 ± 1.6) |
Position of tooth apex from the base of buccal cavity | 16.7 | 16.5-19.5 (17.7± 1.5) | 14-17 (15.5 ± 1.5) |
Nerve ring from anterior end | 190 | 210-244 (226.4± 15.1) | 154-204 (174.9 ± 20.0) |
Excretory pore from anterior end | 225 | 224-271 (253 ± 22.2) | 180.8-232 (204 ± 21.8) |
Pharynx length | 761.0 | 770-975.7 (870 ± 98.5) | 627.7-789.3 (693.2 ± 70.9) |
Anterior branch of genital system | 341 | 341-477 (424 ± 37) | – |
Posterior branch of genital system | 314 | 314-462 (406 ± 38) | – |
Maximum body width | 74.0 | 75.5-87.0 (80.0 ± 5.1) | 60.0-82.0 (71.0 ± 8.0) |
Anal body width | 46.8 | 48.0-58.0 (52.0 ± 4.4) | 55.0-63.0 (59.8 ± 3.3) |
Rectum/cloaca length | 49.2 | 49.0-53.0 (51.5 ± 1.8) | 55-64 (59.5 ± 3.4) |
Vagina length | 34.0 | 36.5-38.5 (37.7 ± 1.0) | – |
Spicule length | – | – | 130-141 (136.8 ± 4.1) |
Spicule width at widest part | – | – | 8.0-11 (9.3 ± 1.4) |
Lateral guiding piece length | – | – | 17.5-23.5 (19.6 ± 2.9) |
Gubernaculum length | – | – | 39.5-44 (42.3± 1.7) |
Number of supplements | – | – | 13-14 |
Distance from cloacal opening to posteriormost supplement | – | – | 20.5-23 (21.4 ± 1.0) |
Distance from cloacal opening to anterior most supplement | – | – | 201-241.5 (218.9 ± 15.8) |
Tail length | 572 | 694-974 (818 ± 125.3) | 500-798 (623 ± 114) |
Holotype female, four paratype females and six paratype males in good condition of preservation. Holotype female on slide
Soil around the roots of random forest trees in the Bat Xat Nature reserve (N = 22°37′14″ and E = 103°37′24″, altitude 1,900 m), Bat Xat District, Lao Cai Province, Vietnam.
The specific epithet refers to the morphology of the labial region (lips lotus-petals shaped) that characterizes this species.
Measurements: see Table 1.
Large size of nematodes. Body ventrally arcuate after fixation. Body tapering slightly anterior to vulva position but more sharply toward posterior end. Maximum body width at the level of vulva. Cuticle smooth, 4.7 (3.4-5) µm thick at the base of pharynx, sub-cuticle distinctly striated. Labial region offset by a depression from the body contour, 2.8 to 3 times as wide as high. Labial region slightly separated six lips in the shape of lotus-petals with prominent labial papillae. Anterior sensilla arranged in two circles: an anterior one of six inner labial papillae, posterior crown with six outer labial papillae and four cephalic papillae protruding beyond the body outline. Buccal cavity begins at 19-22 μm from the anterior end of the body, large size, 1.6-1.8 as long as wide, barrel shaped, its wall strongly sclerotized, vertical plates parallel, basal oblique plates flattened. Amphidial fovea small, cup-shaped, with oval aperture 4-5 μm wide, located around at the beginning of buccal cavity or slightly lower. Dorsal tooth small size, located at the base of vertical plates, apex pointed forward, at 22.5 (21.6-23.4) % its length from the base of buccal cavity. Two small but prominent foramina present at the base of the buccal cavity. About the posterior fifth of buccal cavity embedded in pharyngeal tissues.
Body diameter length at the pharynx base about 1.2 to 1.4 times head width. Pharynx cylindrical, surrounded by the nerve ring, located at 26 (24-27) % of its length, measured from the anterior body end, respectively. Secretory-excretory (SE) pore conspicuous, situated just posterior to nerve ring at 29 (28-30) % of its length from anterior body end. Pharyngo-intestinal junction tuberculate; cardia with conoid projection into wide intestinal lumen. Distance between pharynx base and vulva 1.7 to 2.0 times of the pharynx length. Rectum slightly curved, as long as anal body width. Tail long filiform, 0.7 to 1 mm long, ventrally curved, correspondence 16 to 22% of body length or 12.2 to 19.0 anal body diameters long; three small caudal glands in tandem and opening on terminal tail.
Genital system typical for the genus, didelphic-amphidelphic, both branches about equally developed: anterior branch occupies 9.4 (8.9-10.4) % of body length and posterior branch occupies 9.0 (8.5-10.2) % of body length. Ovaries reflexed, 100 to 145μm long in anterior branch and 85 to 120 μm long in posterior branch; oocytes arranged in a row except at its tips. The uterus is relatively long, 170 to 240 μm long in each branch; sphincter present at the oviduct-uterus junction, valve sclerotized. Oviduct length 133 to 203 μm in anterior branch and 123 to 200 μm in posterior branch, with well-marked
Males are similar to females in general morphology, but more strongly curved to coiled in the posterior region. Buccal cavity smaller than females, 36–41×61.5–67 μm. Genital system diorchic, testes pared, outstretched and opposed, 1.2 to 1.7 mm long. Spicules slender, ventrally arcuated with bifurcate terminus, 2.1 to 2.4 times longer than body diameter at cloacal aperture and 8 to 11 μm long at the widest part. The head of spicule round-shape, 13 to 19 μm long and 7.5 to 9.5 μm wide; offset by shallow depression. The median piece is 104 to 115 μm long and 3.5 to 4.5 μm wide; round blade part. Lateral guiding pieces straight with bifurcate terminus, 18 to 24 μm long. This furcation is symmetrical and well-marked. Gubernaculum is well developed, 39 to 44 µm long (following Peña-Santiago et al., 2014). Ventromedian supplements 13 to 14 in number, conical and regularly arranged, occupies 5 to 7.7% of the body length. The most anterior supplement is situated at 201 to 242 µm from cloacal aperture. The distance between the first and last supplement is 178 to 220 µm. Male tail is 500 to 800 µm long, slightly shorter than the female tail.
In general appearance
From
Table 2 presents a compendium of
Compendium of the species belonging to the genus
Species |
|
|
|
|
|
|
|
B.C.L. | B.C.W. | %DT | Spinneret | Female gonad | Spicule length | Number Suppls | Country | Reference |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
9♀♀ | 2.7-3 | 40-51 | 4.6-5.0 | 5.8-12.3 | 5.9-12.8 | 64-72 | 42-47 | 27-31 | 33-36 | Terminal | Pseudo-prodelphic | Malaysia | Loof (2006) | ||
2♂♂ | 2.7-2.8 | 54 | 4.7-4.8 | 6.8 | 8.3-8.5 | 42-43 | 25-26 | 90-91 | 11 | |||||||
|
11♀♀ | 1.9-2.1 | 29-34 | 3.8-4.7 | 9.1-11.8 | 6.1a | 71-75 | 40-50 | 28-32 | 23a | Subdorsal | Monodelphic | Nigeria | Mulvey and Jensen (1967) | ||
11♂♂ | 2.0-2.4 | 27-34 | 4.0-4.4 | 9.5-11.8 | 4.3a | 40-45 | 27-31 | 78-88 | 6-8 | |||||||
|
10♀♀ | 1.8-2.2 | 32-39 | 5.3-6 | 12-15.5 | 4.3a | 61-66 | 37-38 | 24-26 | 28a | No | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
10♂♂ | 1.4-1.9 | 28-40 | 4.4-5.5 | 13.2-15.6 | 2.7a | 26-37 | 17-23 | 67-83 | 9-12 | |||||||
4♀♀ | 1.7-2.4 | 31-41 | 13.6-18 | 3.9a | 63-66 | 39-43 | 20-27 | No | Didelphic | USA | Mulvey (1963a) | |||||
|
?♀♀ | 2.2-2.5 | 36-43 | 5.4-5.6 | 34-41 | 1.3-1.8 | 70-72 | 44-48 | 28-33 | No | Didelphic | Ukraine | Susulovsky (1998) | |||
|
5♀♀ | 2.2-2.4 | 20-30 | 4.4-4.7 | 4.3-4.8 | 8.3-10 | 51-54.4 | 57-65 | 32-38.5 | 23a | Terminal | Didelphic | Ecuado | Vinciguerra and Orselli (2006) | ||
|
1♀ | 1.72 | 30 | 3.7 | 12.9 | 5a | 68 | 40 | 17 | 23a | Terminal | Monodelphic | Thailand | Buangsuwon and Jensen (1966) | ||
|
8♀♀ | 1.7-1.8 | 35-41 | 4.4-4.7 | 4.9-6 | 9.2-10.5 | 55-57 | 38-41 | 24-28 | 24-34 | No | Didelphic | Japan | Khan et al. (2000) | ||
|
8♀♀ | 2.7-3.5 | 35-39 | 4.4-4.7 | 10-13 | 4.3-5.8 | 62-74 | 67-80 | 40-44 | 19-27 | Terminal | Didelphic | India | Dhanam and Jairajpuri (1998) | ||
3♂♂ | 2.9 | 41 | 4.6-4.7 | 11-15 | 2.9-4.3 | 64-67 | 34-35 | 125-138 | 17-19 | |||||||
|
9♀♀ | 1.5-1.7 | 28-37 | 4.0-4.6 | 5-7 | 12.2a | 62-70 | 32-37 | 28-32 | 29-34 | Subventral | Monodelphic | India | Jairajpuri (1969) | ||
9♂♂ | 1.5-1.7 | 31-35 | 4.3-4.8 | 5-7 | 6.8a | 28-32 | 24-26 | 25-28 | 80-93 | 9-10 | ||||||
|
6♀♀ | 1.7-2.4 | 25-32 | 3.7-4.3 | 6.5-8.6 | 6.6a | 55-60 | 48a | 30a | 25 | Terminal | Didelphic | New zealand | Clark (1960) | ||
1♂ | 2 | 30 | 3.9 | 8.6 | 4.8a | 83a | 14 | |||||||||
|
1♀ | 3.2 | 33.3 | 4.8 | 17 | 3.7a | 65 | 64a | 53a | Terminal | Didelphic | USA | Mulvey (1963a), (after Cobb, 1917) | |||
1♂ | 3.5 | 40 | 5.3 | 17 | 95 | 16 | ||||||||||
|
13♀♀ | 2.5-3.5 | 31-44 | 4.2-5.1 | 4.3-6.6 | 12.1a | 56.5-60 | 46-62 | 36-52 | 23-35 | No | Didelphic | Romania | Popovici (1990) | ||
16♂♂ | 2.1-3.7 | 33-47 | 4.3-5.1 | 4.9-6.7 | 47-57 | 33-50 | 72-100 | 11-13 | ||||||||
|
4♀♀ | 0.8-1 | 24-32 | 3.5-4.5 | 3.8-4.9 | 59-64 | 22-25 | 9-14 | Terminal | Monodelphic | Thailand | Buangsuwon and Jensen (1966) | ||||
6♀♀ | 0.9-1 | 24-26 | 3.8-3.9 | 5.8-6 | 6.7-7.4 | 63-65 | 26-30 | 14-17 | Subventral | Monodelphic | India | Mohadas and Prabhoo (1979) | ||||
|
6♀♀ | 1.7-2 | 28-34 | 3.9-5.2 | 4.6-5.9 | 8.8a | 52-58 | 40-43 | 23-29 | 20a | No | Didelphic | Nigeria | Mulvey and Jensen (1967) | ||
|
?♀♀ | 2.8-3.5 | 34-41 | 4.5-4.9 | 6.6-7.6 | 7.3a | 68-69 | 60-63 | 37-40 | Terminal | Monodelphic | Brazil, Hawaii | Mulvey (1963a), (after Cobb, 1917) | |||
|
5♀♀ | 2.9-3.2 | 39-44 | 4.2-4.3 | 10.7-12.2 | 4.7-5.2 | 64-66 | 57-60 | 34-39 | 23 | Terminal | Didelphic | Korea | Khan et al. (2002) | ||
|
12♀♀ | 2.8-3 | 30-37 | 4.6-5.8 | 7-10 | 5.5-7.8 | 62-64.5 | 57-65 | 33-37 | 22-25 | Terminal | Didelphic | India | Jana et al. (2007) | ||
7♂♂ | 2.3-3.1 | 30-39 | 4.4-5.4 | 9.6-14.5 | 3.1-3.6 | 50-57 | 26-30 | 123-133 | 11-15 | |||||||
|
3♀♀ | 1.6-1.7 | 20-22 | 2.9-3 | 17-1.7 | 1.7-2.2 | 71-75 | 58-61 | 35-37 | 29-32 | No | Didelphic | Korea | Choi and Khan (2000) | ||
|
1♀ | 2.4 | 37.5 | 4.2 | 6.5 | 9.5 | 69 | 54 | 30 | 26 | No | Monodelphic | Côte d’Ivoire | Siddiqi (2001) | ||
|
8♀♀ | 1.7-2.1 | 25-30 | 3.9-4.5 | 12.4-14 | 3.4a | 65-68 | 38-43 | 22-24 | 29a | Terminal | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
7♂♂ | 1.7-1.9 | 28-33 | 4.0-4.8 | 14.6-17.5 | 2.5a | 37-39 | 18-20 | 77-88 | 11-14 | |||||||
|
?♀♀ | 2.4 | 31 | 5 | 7.1 | 8.2 | 59 | 54 | 37 | No | Didelphic | India | Dhanam and Jairajpuri (2002) | |||
|
4♀♀ | 1.5-1.6 | 28-30 | 3.7-4.1 | 24-26 | 1.7-1.9 | 63-65 | 40-42 | 26-27 | 24-25 | No | Didelphic | Japan | Khan et al. (2008) | ||
|
1♀ | 2 | 33 | 4 | 7.1 | 7.1 | 70 | 58 | 34 | 20a | Terminal | Monodelphic | Guinae | Siddiqi (2001) | ||
2♂♂ | 1.9-2.0 | 35-43 | 3.9-4.7 | 5.9-6.9 | 6.9-8.3 | 47 | 26-27 | 74-89 | 4-6 | |||||||
|
1♀ | 2.9 | 40 | 4.2 | 7.1 | 9a | 67 | 57 | 40 | Terminal | Monodelphic | Fiji, Brazil, USA | Mulvey (1963a), (after Cobb, 1917) | |||
|
4♀♀ | 2-2.2 | 33-44 | 4.7-5.4 | 9.4-10.8 | 5.3-6.1 | 60-63 | 37-40 | 24-26 | 26-27 | No | Didelphic | Japan | Khan et al. (2008) | ||
3♂♂ | 2.1-2.3 | 41-44 | 4.4-5.4 | 8.7-9.3 | 5.9-6.3 | 38-40 | 24-25 | 68-75 | 9-11 | |||||||
|
28♀♀ | 1.5-2 | 21-32 | 4.0-4.8 | 5-8 | 10a | 57-65 | 40-47 | 28-32 | 23-25 | Subventral | Didelphic | India | Jairajpuri (1969) | ||
|
4♀♀ | 2.6-2.7 | 50-57 | 4.9-5.2 | 4.0-4.5 | 17-18 | 53-55 | 43-48 | 23-25 | 23-27 | Subventral | Didelphic | Cameroon | Siddiqi (2001) | ||
3♂♂ | 2.4-2.5 | 49-57 | 4.9-5.1 | 4.1-4.6 | 13-14.6 | 41-43 | 18-19 | 63-73 | 10-11 | |||||||
|
5♀♀ | 3-3.3 | 40-46 | 4.2-4.6 | 6.8-7.8 | 7.8-9.1 | 67-72 | 58-64 | 32-33 | 26a | Terminal | Pseudo–prodelphic | Fiji | Siddiqi (1984) | ||
4♀♀ | 2.8-3.3 | 37-40 | 3.6-4.2 | 13.5-17.8 | 3.1-4.2 | 72-74 | 60-62 | 31-33 | ||||||||
|
?♀♀ | 1.4-1.8 | 20-23 | 3.2-3.7 | 23-28 | 1.5-2 | 72-75 | 42 | 30 | No | Didelphic | Kirghistan | Sultanalieva (1983) | |||
?♂ | 1.6 | 19-22 | 3.3-3.8 | 20-25 | 22 | |||||||||||
|
4♀♀ | 2.1-2.5 | 30-36 | 4.1-4.2 | 4.1-5.5 | 8-11 | 54-58 | 57-60 | 29-30 | 19-20 | Subventral | Didelphic | Cameroon | Siddiqi (2001) | ||
1♂ | 1.8 | 29 | 4.5 | 5.8 | 7.2 | 49 | 24 | 90 | 12 | |||||||
|
2♀♀ | 2 | 39-45 | 4.6 | 6.1-6.2 | 10.2 | 63-64 | 36-37 | 26 | 24-25 | Subventral | Monodelphic | New Caledonia | Yeates (1992) | ||
3♂ | 1.8-2.1 | 38-45 | 4.2-4.9 | 6.1-7.2 | 7.4-8.9 | 32-35 | 23-29 | 27-29 | 47-57 | 9-12 | ||||||
|
4♀♀ | 1.6 | 32-35 | 4.1-4.4 | 7.2-7.9 | 6.4a | 65-66 | 33-41 | 25-27 | 22a | No | Monodelphic | Côte | Malcevschi (1981) | ||
1♂ | 1.6 | 31 | 4 | 8.3 | 4.1a | 35 | 22 | 50 | 9 | d’Ivoire | ||||||
|
2♀♀ | 2.1-2.3 | 24-26 | 5 | 10-11 | 4.5a | 61-62 | 61a | 42a | 25 | Terminal | Didelphic | South | Coetzee (1967b) | ||
2♂♂ | 2.6-2.8 | 36-37 | 4-5 | 16 | 2.7a | 104-112 | 15-17 | Africa | ||||||||
1♀ | 2.7 | 34 | 4.1 | 15.1 | 3.6 | 68 | 54 | 39 | Terminal | Didelphic | South Africa | De Bruin and Heyns (1992) | ||||
2♂♂ | 2.6-2.8 | 35-37 | 4.4-4.7 | 18.4-21 | 2.2-2.6 | 49 | 32-35 | 107-111 | 13-14 | |||||||
|
2♀♀ | 1.8-2.4 | 32-38 | 4.1 | 9.1-10.9 | 5.2-5.4 | 71 | 50-60 | 25-31 | 28a | Terminal | Monodelphic | Côte | Siddiqi (2001) | ||
1♂ | 2.35 | 47 | 3.9 | 7.3 | 7.8 | 54 | 25 | 88 | 4 | d’Ivoire | ||||||
|
3♀♀ | 1.9-2 | 34-42 | 4.3-5.1 | 7.3-8.6 | 6.8-9.5 | 61-68 | 30-38 | 22-25 | 29a | No | Didelphic | South Africa | De Bruin and Heyns (1992) | ||
|
5♀♀ | 3.8-5.2 | 50-59 | 4.9-5.4 | 4.5-6.3 | 12-20 | 54-59 | 70-88 | 41-54 | 22-23 | Terminal | Didelphic | Vietnam | Currently paper | ||
6♂♂ | 3-4.2 | 44-52 | 4.7-5.4 | 5.3-5.9 | 8.2-13 | 62-67 | 36-41 | 21-25 | 130-141 | 13-14 | ||||||
|
1♀ | 4.2 | 38 | 4.9 | 86 | 0.7 | 69 | 51 | 26 | 40 | No | Didelphic | Hungary | Andrássy (1973) | ||
|
2♀♀ | 2.2-2.3 | 42-44 | 5.2-5.3 | 4.2-4.3 | 14-14.7 | 52-53 | 40 | 23 | 23a | Subdorsal | Didelphic | Cameroon | Siddiqi (2001) | ||
3♂♂ | 2.0-2.1 | 46-47 | 5.3-5.6 | 4.0-4.4 | 12-13.5 | 37-39 | 19-20 | 56-62 | 10 | |||||||
|
9♀♀ | 3.2-3.5 | 44-50 | 4.6-5.0 | 7.6-8.4 | 7.5-8.3 | 60-61 | 64-72 | 42-45 | 24-27 | Terminal | Didelphic | Japan | Khan and Araki (2002) | ||
5♂♂ | 2.8-3.1 | 45-48 | 4.5-4.7 | 11.2-14 | 3.5-4.7 | 57-62 | 34-40 | 127-138 | 12-13 | |||||||
|
4♀♀ | 1.2-1.3 | 29-31 | 3.7-3.9 | 5.7-6 | 61-64 | 34-36 | 19-20 | Terminal | Monodelphic | Singapore | Thong (1970) | ||||
|
3♀♀ | 1.5-1.6 | 33-36 | 4.1-4.4 | 4.1-4.7 | 11-13.7 | 58-62 | 36-37 | 19-20 | 17-19 | Subventral | Monodelphic | Cameroon | Siddiqi (2001) | ||
|
13♀♀ | 2.3-2.7 | 31-34 | 4.2-4.6 | 12-16 | 4.0-4.9 | 62-67 | 55-64 | 34-38 | 27-28 | Terminal | Didelphic | India | Mohadas and Prabhoo (1979) | ||
4♂♂ | 2.2-2.5 | 31-33 | 4.1-4.6 | 13-16.5 | 2.5-2.9 | 52-54 | 28-30 | 117-126 | 15-16 | |||||||
8♀♀ | 2.3-2.7 | 27-34 | 4.0-4.6 | 10-12 | 65-70 | 51-54 | 32-36 | Terminal | Didelphic | India | Khan and Jairajpuri (1980) | |||||
10♂♂ | 2.3-2.6 | 30-37 | 4.1-4.7 | 10-13 | 112-131 | 12-16 | ||||||||||
|
8 ♀♀ | 1.8-2.7 | 39-47 | 4.3-4.9 | 4.3-6.9 | 8-15 | 50-57 | 46-54 | 21-27 | 24-26 | Subventral | Didelphic | Cameroon | Siddiqi (2001) | ||
3♂♂ | 1.8-2.2 | 42-45 | 4.3-4.8 | 4.4-6.9 | 8.9-11.7 | 45-50 | 21-22 | 66-75 | 10-12 | |||||||
|
7♀♀ | 1-1.2 | 22-25 | 3.1-3.8 | 13-16 | 2.2-2.8 | 66-70 | 36-40 | 22-23 | 17-20 | Terminal | Monodelphic | Papua New Guinea | Andrássy (2008) | ||
|
11♀♀ | 1.6-1.9 | 25-35 | 3.9-4.6 | 10-13 | 5.4a | 68-72 | 36-40 | 21-29 | 23a | No | Monodelphic | Nigeria | Mulvey and Jensen (1967) | ||
11♂♂ | 1.4-1.7 | 28-36 | 3.9-4.5 | 12-16 | 3.3a | 32-35 | 20-23 | 63-70 | 6-8 | |||||||
|
4♀♀ | 2-2.3 | 33-36 | 4.1-4.4 | 18-20 | 2.7-3.3 | 62-63 | 38-41 | 24-26 | 24 | No | Didelphic | Japan | Khan et al. (2008) | ||
2♂♂ | 2.1-2.3 | 32-34 | 4.4-4.6 | 14-15 | 2.5-2.7 | 45-47 | 25-28 | 90-95 | 12-14 | |||||||
|
1♀ | 2.8 | 33 | 4.2 | 61 | 1 | 68 | 61 | 45 | 21 | No | Didelphic | Korea | Choi et al. (1999) | ||
|
2♀♀ | 2.4-2.5 | 35-36 | 4.6-4.8 | 7-8 | 7 | 61 | 55 | 33-35 | 26-28 | No | Didelphic | Korea | Jairajpuri et al. (2000) | ||
1♂ | 2.1 | 34 | 4.6 | 8 | 5 | 50 | 30 | 23 | 82 | 11 | ||||||
|
7♀♀ | 2.2-2.6 | 26-37 | 4.3-4.9 | 7.2-8.7 | 6.9a | 56-60 | 48-55 | 29-32 | 23a | Terminal | Didelphic | Nigeria | Mulvey and Jensen (1967) | ||
5♂♂ | 2.0-2.4 | 29-38 | 4.3-4.7 | 9.1-11.2 | 4.2a | 42-50 | 25-28 | 26a | 90 | 13-15 | ||||||
1♀ | 1.7 | 24.4 | 4.3 | 6.6 | 6.5 | 58 | 49 | 26 | Cameroon | Siddiqi (2001) | ||||||
|
2♀♀ | 1.9-2.2 | 23-26 | 5-5.1 | 9.4-10.4 | 3.5-4.6 | 62-63 | 57-68 | 35-40 | 23a | No | Didelphic | Italia | Vinciguerra and Orselli (2000) | ||
2♂♂ | 1.6 | 23-24 | 4.6 | 10-11.3 | 2.8-3.0 | 52.5 | 30-32.5 | 57.5-66 | 10-11 | |||||||
|
31♀♀ | 1.8-2.4 | 39-53 | 5.1-6.2 | 17-24.9 | 2.5-4.3 | 63-69 | 29-40 | 20-27 | 25-37 | Subdorsal | Didelphic | Spain | Jiménez-Guirado (1994) | ||
20♂♂ | 1.7-2.2 | 36-53 | 5.1-6.1 | 24-32 | 1.6-2.2 | 27-34 | 18.5-21.5 | 53.5-67 | 9-13 | |||||||
|
5♀♀ | 1.4-1.5 | 27-35 | 4.2-4.6 | 3.6-4.1 | 13.5-15 | 55-58 | 30-32 | 15.5-17 | 23-25 | Subventral | Monodelphic | Cameroon | Siddiqi (2001) | ||
2♀♀ | 1.3-1.4 | 23-25 | 4.3-4.5 | 3.1-3.9 | 10.3-13 | 30 | 17-19 | |||||||||
|
5♀♀ | 1.3-1.6 | 35-42 | 4.8-5.1 | 8.4-9.3 | 6.2a | 59-63 | 29-30 | 18-19 | 30a | No | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
6♂♂ | 1.3-1.4 | 38-45 | 4.6-5.1 | 10-11.2 | 3.7a | 26-29 | 14-15 | 52-53 | 8-9 | |||||||
|
6♀♀ | 1.4-1.6 | 31-34 | 4.2-4.7 | 4.1-4.7 | 60-63 | 36-39 | 25-27 | 31-36 | Subventral | Pseudo-prodelphic | India | Ahmad and Jairajpuri (1983) | |||
4♂♂ | 1.4-1.7 | 33-41 | 4.4-4.7 | 4.6-5.1 | 60-64 | 6-8 | ||||||||||
|
14♀♀ | 0.7-1 | 24-30 | 3.6-4.3 | 7.0-8.1 | 4.7-6.9 | 63-67 | 22-24 | 10-13 | 20-29 | No | Monodelphic | Malaysia | Loof (2006) | ||
|
1♀ | 2.1 | 43 | 4.6 | 5.8 | 11 | 63 | 38 | 26 | 26 | Subventral | Monodelphic | New Caledonia | Yeates (1992) | ||
|
1♀ | 2 | 37 | 4.9 | 9.5 | 7.7a | 57 | 46 | 22 | 33a | Subdorsal | Didelphic | Thailand | Buangsuwon and Jensen (1966) | ||
|
5♀♀ | 1.5-1.8 | 30-38 | 5 | 14-15 | 4.2a | 68-72 | 34a | 22a | 29 | Terminal | Didelphic | South | Coetzee (1967b) | ||
12♂♂ | 1.7-1.9 | 31-40 | 5 | 15-19 | 3.2a | 60-70 | 11-12 | Africa | ||||||||
10♀♀ | 1.4-1.9 | 27-35 | 3.9-4.5 | 10-13.3 | 3.6-5.1 | 61-70 | 29-39 | 18-24 | Terminal | Didelphic | South Africa | De Bruin and Heyns (1992) | ||||
8♂♂ | 1.3-1.7 | 28-37 | 4.1-5.1 | 14-17.7 | 2.5-2.8 | 66-74 | 6-11 | |||||||||
|
1♀ | 3.3 | 33 | 4.6 | 8.9 | 6.2a | 64 | 58 | 47 | 29a | Terminal | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
4♀♀ | 2.7-3.4 | 34-37 | 4.5-4.7 | 8-10 | 6.3a | 60-64 | 53-64 | 32-40 | Terminal | Didelphic | India | Khan and Jairajpuri (1980) | ||||
?♂♂ | 3.1-3.7 | 36-39 | 4.5-5.1 | 11 | 14-18 | India | Ahmad and Jairajpuri (2010) | |||||||||
|
29♀♀ | 2.3-2.8 | 45-63 | 5.9-7.7 | 55-108 | 0.8-1.4 | 62-69 | 32-45 | 23-25 | 25-32 | No | Didelphic | Spain | Peña Santiago and Jiménez–Guirado (1991) | ||
|
3♀♀ | 1.7-2.1 | 28-35 | 4.4-4.5 | 7.6-8.0 | 6.3-6.6 | 70-72 | 53-55 | 30-31 | 13-15a | Subdorsal | Monodelphic | Guinea | Siddiqi (2001) | ||
3♂♂ | 1.5-1.8 | 35-39 | 3.9-4.5 | 6.8-8.2 | 5.3-5.5 | 40-49 | 22-26 | 76-79 | 8-9 | |||||||
|
4♀♀ | 2.5-2.9 | 40-42 | 4.1-4.6 | 9.3-11 | 5.3-6 | 60-65 | 58-60 | 38-40 | 23-27 | Terminal | Didelphic | Japan | Khan et al. (2000) | ||
5♂♂ | 2.2-2.6 | 39-46.5 | 4.1-4.6 | 11.5-14 | 3.2-4.5 | 46-55 | 30-32 | 102-109 | 10-12 | |||||||
|
4♀♀ | 1.4-1.9 | 27-36 | 4.0-4.3 | 4.8-5.4 | 11.3a | 62-65 | 41-42 | 24-25 | 27-29 | Subventral | Monodelphic | India | Ahmad and Jairajpuri (1983) | ||
|
16♀♀ | 1-1.23 | 36-41 | 3.7-4.2 | 5.1-6.7 | 6.3-8.3 | 59-65 | 31-33 | 18-19 | 29-33 | Terminal | Monodelphic | Sigapore | Ahmad et al. (2005) | ||
|
8♀♀ | 1.8-2.6 | 31-38 | 3.7-4.5 | 6-7 | 8-11 | 66-80 | 46-54 | 25-31 | 26-31 | Subventral | Monodelphic | India | Dhanam and Jairajpuri (1998) | ||
1♂ | 2.2 | 35 | 4.3 | 9 | 5 | 52 | 24 | 24 | 76 | 12 | ||||||
|
9♀♀ | 3.3-4.3 | 41-49 | 5.2-5.9 | 7.1-8.8 | 7.4-10.2 | 58-73 | 50-57 | 32-41 | 33a | No | Didelphic | New Zealand | Yeates (1988) | ||
9♂♂ | 3.2-3.7 | 45-54 | 5.1-6 | 7.9-9.2 | 6.2-7.5 | 48-55 | 28-41 | 68-70 | 11-12 | |||||||
|
21♀♀ | 1.7-2.2 | 27-41 | 4.4-5.9 | 3.3-4.0 | 16a | 47-51 | 40-43 | 23-27 | 23a | No | Didelphic | Nigeria | Mulvey and Jensen (1967) | ||
2♂♂ | 1.6-1.7 | 34-39 | 4.3-4.4 | 4 | 38 | 23 | 60-65 | ? | ||||||||
3♀♀ | 2.1-2.4 | 34-37 | 4.1-5.5 | 4.1-4.5 | 15-17 | 51-54 | 44-47 | 22-26 | 19a | No | Didelphic | Cameroon | Siddiqi (2001) | |||
|
10♀ | 1.9-2.5 | 28-35 | 4.0-4.5 | 4.9-5.6 | 10a | 53-57 | 45-52 | 27-31 | 23a | Subventral | Didelphic | Nigeria | Mulvey and Jensen (1967) | ||
|
4♀♀ | 2.2-2.8 | 41-48 | 4.8-5.2 | 4.4-5.9 | 12.6-17 | 51.5-59 | 49-50 | 23-24 | 26a | Terminal | Didelphic | Togo | Siddiqi (2001) | ||
|
2♀♀ | 1.5-1.6 | 28-35 | 4.5 | 7.3-7.9 | 6.7a | 62 | 36-38 | 21-23 | 31a | No | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
6♀♀ | 1.6-1.7 | 38-48 | 3.7-5.7 | 6.0-7.2 | 8.7a | 56-66 | 32-35 | 21-25 | 36.4a | No | Didelphic | Thailand | Buangsuwon and Jensen (1966) | |||
|
?♀ | 1.2 | 34.5 | 4.8 | 3 | 15-20 | 52 | 28 | 17 | Australia, Fiji, Brazil, Nigeria, Mauritius | Mulvey (1963a), (after Cobb, 1917) | |||||
?♀♀ | 1.3-2.1 | 28-46 | 3.5-5.4 | 3-5 | 15-20 | 53-62 | 20-35 | 20-25 | Terminal | Monodelphic | Mulvey (1963a) | |||||
?♂ | 1.7 | 28 | 4.4 | 3.6 | 78 | 8-10 | ||||||||||
7♀♀ | 1.3-1.6 | 37-41 | 3.7-4.7 | 3.4-4 | 13-18 | 54-60 | 26-28 | 16-18 | 25-27 | Terminal | Monodelphic | India | Jairajpuri (1969) | |||
1♀ | 1.7 | 37 | 4.6 | 4 | 16 | 61 | 30 | 16 | 26 | Subventral | Monodelphic | Costa Rica | Zullini et al. (2002) | |||
|
7♀♀ | 1.5-1.6 | 23-26 | 2.8-3.2 | 17-19.4 | 2.0-2.4 | 67-73 | 52-63 | 31-36.5 | 27-36 | No | Didelphic | Korea | Choi and Khan (2000) | ||
5♂♂ | 1.5-1.7 | 24-27 | 3.2-3.3 | 19.6-23 | 1.4-1.6 | 52-58 | 30-34 | 75-92 | 20-22 | |||||||
|
20♀♀ | 1.3-2 | 27-36 | 3.8-4.7 | 9.6-13.3 | 4a | 69-76 | 33-41 | 22-27 | 22a | Subdorsal | Monodelphic | Côte | Malcevschi (1981) | ||
8♂♂ | 1.3-2 | 29-37 | 3.9-4.6 | 10.3-13 | 3a | 32-37 | 20-24 | 68-73 | 7-10 | d’Ivoire |
Currently, 78 species of the genus
Female genital organ unpaired, prodelphic, or pseudo-prodelphic with rudimentary post genital branch .........................…..….…. 2
Female genital organ paired, amphidelphic ……….................................................................... 28
Genital organ pseudo-prodelphic with rudimantary post genital branch ….........…………. 3
Genital organ monoprodelphic …………………. 5
Small nematode:
Large nematode:
Caudal spinneret absent………...............… 6
Caudal spinneret present ….……..................… 9
Larger body size:
Smaller body size:
Shorter body length:
Longer body length:
Caudal spinneret subterminal ……………… 10
Caudal spinneret terminal …………………...…19
Caudal spinneret subdorsal ………………… 11
Caudal spinneret subventral …………………... 13
Buccal cavity length >50 µm (53-55×30-31) ………….…
Buccal cavity length <50 µm ………………… 12
Tail 6 anal body diameter long; larger size of buccal cavity = 40-50×28-32 µm ..………..…
Tail 4 anal body diameter long; smaller size of buccal cavity = 33-41×22-27 µm …................. …………...…....………...
Post-uterine sac completely absent …………. 14
Post-uterine sac present …..…....................... 15
Buccal cavity length >40 µm (41-42×24-25 µm); ♂: unknown ……..……..…..
Buccal cavity length <40 µm (32-37×28-32 µm); ♂: unknown ……...…….
Post-uterine sac = 3.5 body diameter long; ♂: unknown ………
Post-uterine sac <1 body diameter long …… 16
Buccal cavity length ≥60 µm (buccal cavity = 60-63×37-40 µm); ♂: unknown ............ ......................................
Buccal cavity length ≤60 µm (buccal cavity = 57×40 µm); ♂: unknown ….........................................……….
Post-uterine sac completely absent ………… 22
Post-uterine sac present …….......................... 26
Shorter body length:
Longer body length:
Buccal cavity length ≤30 µm (22-24×10-13 µm) ………….........................................................
Buccal cavity length >30 µm ………………. 24
Slenderer nematode:
Post-uterine sac<body diameter long; buccal cavity = 40×17 µm; ♂: unknown … ………..
Post-uterine sac>body diameter long; larger buccal cavity size …….………................…….. 27
Buccal cavity oval; 50-60×25-31 µm; post-uterine sac = 2.5-3.5 body diameter long …………
Broader buccal cavity; 58×34 µm; post-uterine sac = body diameter long …...............................................................................
Caudal spinneret absent …….......……….. 29
Caudal spinneret present ………..................... 50
Tail broadly rounded, hemispheroid, less than 1.5 anal body diameter long ……….... 30
Tail conoid-arcuate of filiform, longer than 1.5 anal body diameter long ……….….................. 32
Larger nematode:
Smaller nematodes:
Slenderer nematodes:
Stout nematode:
Tail<6.5 anal body diameter long ……………. 33
Tail>6.5 anal body diameter long ………….... 42
Buccal cavity length >50 µm ……………… 35
Buccal cavity length <50 µm …………...…… 36
Lip region lower (17-20 µm), labial papillae weakly developed; buccal cavity flattened at base …………...
Lip region higher (21-22 µm); labial papillae prominent, protruded; buccal cavity narrowing posteriorly ………....................................................................…
Large nematode:
Smaller nematode:
Vagina without sclerotised pieces ………
Vagina with sclerotised pieces …………....… 38
Larger buccal cavity = 57.5-67.5×35-40 µm ...…..….
Buccal cavity length <50 µm ……………...… 39
Tail>4 anal body diameter long ……………… 40
Tail<4 anal body diameter long …………........ 41
Tail conoid,
Tail elongated-conoid,
Shorter nematode:
Larger nematode:
Tail>12 anal body diameter long …………..… 43
Tail<12 anal body diameter long ……….....… 44
Larger nematode:
Smaller nematode:
Advulval papillae absent ……………….……… 46
Advulval papillae present ……………...…...… 48
Smaller nematode:
Larger nematode:
Slenderer nematode:
Vagina without sclerotised pieces ……….…
Vagina with sclerotised pieces .........................… 49
Slenderer nematode:
Caudal spinneret subterminal …………..... 51
Caudal spinneret terminal …........................… 58
Caudal spinneret subdorsal .................………. 52
Caudal spinneret subventral ……….……...… 54
Tail>14 anal body diameter long …......................................................…..…
Tail<14 anal body diameter long ……….....… 53
Advulval papillae absent …………….………… 55
Advulval papillae present ………………......… 57
Longer length of buccal cavity = 57-60 µm ….................…
Length of buccal cavity<55 µm ………...…… 56
Vulva posteriorly:
Vulva anteriorly:
Slenderer nematode:
Large nematode:
Smaller nematode:
Length of buccal cavity>65 µm …………… 60
Length of buccal cavity<65 µm …….......…… 62
Advulval papillae absent …..............……
Advulval papillae present .......................……... 61
Larger body length:
Tail shorter:
Tail longer:
Advulval papillae present …………………...… 65
Advulval papillae absent ……………..….…… 68
Vulva posteriorly:
Caudal cuticular pores absent …………….………
Caudal cuticular pores present …...………… 67
Length of buccal cavity width = 39-42 µm; Tail shorter:
Length of buccal cavity width = 33-37 µm;
Tail short:
Molecular sequences of two individuals of
A BLAST search for matches to the partial 18S rDNA sequence of new species
The results derived from the analyses of these 18S and D2-D3 region of 28S sequences are presented in the molecular trees of Figures 5 and 6, respectively. In both phylogenetic trees, the new species
Phylogenetic relationships of
Phylogenetic relationships of
During this study, the new species