Laimaphelenchus africanus n. sp. (Tylenchomorpha: Aphelenchoididae) from South Africa, a morphological and molecular phylogenetic study, with an update to the diagnostics of the genus

Several dead bark and wood samples of coniferous trees (Pinus pinaster) were collected in Potchefstroom, South Africa. The samples were cut into smaller pieces for nematode extraction purpose. The tray method of Whitehead and Hemming (1965) was used to extract the nematodes, which were then killed with a hot 4% formaldehyde solution, transferred to anhydrous glycerin using De Grisse (1969) method and mounted on permanent slides. The specimens were examined using a Nikon Eclipse E600 light microscope. Photomicrographs were taken using an Olympus DP72 digital camera attached to an Olympus BX51 microscope equipped with differential interference contrast. Drawings were made using a drawing tube attached to the microscope and were redrawn using the CorelDRAW® software version 2017.

For the scanning electron microscopy, specimens preserved in glycerine were selected for observation under SEM according to the Abolafia’s (2015) protocol. The nematodes were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried with liquid carbon dioxide, mounted on SEM stubs, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany).

For DNA extraction, two live female individuals of the collected population of Laimaphelenchus were isolated, washed using distilled water, observed after being mounted on temporary slides, and photographed. The specimens were then transferred to two individual Eppendorf tubes containing 15 µl ddH₂O and their respective DNA was extracted using the chelex-100 protocol of Rashidifard et al. (2019). The DNA samples were stored at –20°C until used for amplification. The partial sequences of the large subunit ribosomal DNA (LSU rDNA D2-D3) were amplified using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGT–3′) and reverse primer D3B (5′–TCGGAAGGAACCAGCTACTA–3′) (Nunn, 1992). The polymerase chain reaction (PCR) was performed in the same conditions describe by Pedram (2019). The newly obtained LSU D2-D3 sequences were deposited into the GenBank database under the accession numbers MW507183 and MW507184.

The raw file of the newly generated partial sequences of LSU rDNA of Laimaphelenchus africanus n. sp. were manually checked, edited, and compared with those of the relevant sequences available in the GenBank database using the BLAST homology search program. Sequences of several representatives of the aphelenchoidids were selected for LSU phylogeny. The multiple alignment of 87 selected sequences was conducted using MUSCLE (Edgar, 2004) as implemented in MEGA6 (Tamura et al., 2013). The resultant alignment was edited manually. The best-fitting substitution model was selected using the Akaike information criterion (AIC) by using PAUP*/MrModeltest v2.2 (Nylander, 2004). A general time reversible model, with proportion of invariable sites and a gamma distribution (GTR + I + G) was selected for the phylogenetic analysis. Bayesian inference (BI) was performed using MrBayes v3.1.2 (Ronquist and Huelsenbeck, 2003) and a random starting tree, running the chains for 5 × 10⁶ generations. After discarding burn-in samples, the remaining samples were retained for further analyses. The Markov chain Monte Carlo (MCMC) method within a Bayesian framework was used to estimate the posterior probabilities of the phylogenetic trees (Larget and Simon, 1999) using the 50% majority rule. The resultant phylogenetic tree was visualized with Dendroscope V.3.2.8 (Huson and Scornavacca, 2012) and drawn in CorelDRAW® software version 2017.

Laimaphelenchus africanus n. sp. (Figs 1–3).

Figure 1:

Figure 2:

Figure 3:

Measurements of the new species are given in Table 1.

Body slender, slightly arcuate ventrally when heat relaxed. Cuticle with fine transverse annulations, 1.0–1.5 µm wide at mid-body according to SEM. Lateral field marked by four incisures, making three bands, the inner one narrower than the two outer ones as visible using SEM (Fig. 3E). Cephalic region rounded, offset by a shallow constriction under light microscopy (LM), 2–4 µm high and 6–7 µm wide, without a labial disc and with six equally sized lips not separated by ribs (visible under SEM). Cephalic papillae four at mid-position of lip region height, labial papillae six surrounding the oral aperture (Fig. 3C). Amphidial openings pore-like, located at mid-position of lateral lips height, slightly dorsally shifted. Stylet slender, anterior conical part about ½ of the total, shaft with three small swellings (Fig. 2C). Pharynx with procorpus cylindrical, 32–43 µm long, median bulb (metacorpus) oval, 13–18 µm long, 10–15 µm wide, with a centrally located valve, 53–67 µm from the anterior end. The pharyngo-intestinal junction (cardia) subcylindrical often with distanced lumen. The dorsal pharyngeal gland well-developed, slender, with three visible nuclei, overlapping intestinal dorsally for 83–141 µm long (Fig. 1A). Nerve ring at 1.2–1.9 times maximum body width posterior to the median bulb, 80–106 µm from the anterior end. Secretory-excretory pore (SE-pore) almost opposite to the nerve ring. Hemizonid not observed. Genital tract mono-prodelphic, ovary outstretched with oocytes in a single row, oviduct short, spermatheca oval to oblong filled with amoeboid (spheroid to oval) sperm cells, crustaformeria with no clearly seen cells, uterus with a wide lumen, vagina directed anteriorly, the sclerotized pieces large, vulva a transverse slit with a well-developed vulval flap overlapping the posterior lip, post-vulval uterine sac (PUS) 63–125 µm long, occupying 3.2–5.3 times vulval body diameter or 23.2–63.1% of the distance from vulva to anus, containing sperm in some individuals. Anus distinct, well developed. Tail conical, ventrally curved, dorsally convex, with a subventral stalk in terminus, lacking tubercles, having six to nine small projections at the tip of the stalk (Fig. 3I–L).

Rare. Only one specimen was recovered. Body slender, similar to that of the females except genital system and posterior body end more ventrally bent. Testis single, outstretched, developing spermatocytes in a single column. Spicules curved, 17 μm long along arc line, capitulum without clear depression in middle, blade (calamus-lamina complex) smoothly ventrally arcuate, condylus bluntly rounded, rostrum triangle-shaped with blunt tip and distal end of spicules bluntly rounded. Only one pair of subventral papillae observed (P3), located at middle of the tail. Bursa absent. Tail curved ventrally, its terminus similar to that of females.

During August 2019, bark and wood were sampled from maritime pine trees (Pinus pinaster) showing gradual decline since 2010 in Potchefstroom, North West province, South Africa (26°42′18.0″ S, 27°07′05.4″ E; elevation 1,353 m.a.s.l.).

The holotype female (accession number: 51317) and four paratype females (accession number: 51318) were deposited in the National Collection of Nematodes (NCN), ARC-PPRI, Pretoria, South Africa. 14 paratype females and paratype male were deposited in the Nematode Collection of Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran. Three paratype females were deposited in the WaNeCo collection, Wageningen, The Netherlands (http://www.waneco.eu/).

The specific epithet refers to the name of its native continent.

Laimaphelenchus africanus n. sp. is characterized by 898 (750–987) µm long females, cephalic region with six lobs not divided by ribs and no disc, 11.8 (10.0– 12.5) μm long stylet, four incisures in the lateral field, SE-pore slightly posterior to the nerve ring, vulva with a well-developed anterior flap, vagina with two well-developed sclerotized pieces, 91 (63–125) µm long PUS, tail 37 (30–44) µm long with a subventral stalk in terminus lacking tubercles but having six to nine small projections at the tip in SEM and rare male with 17 μm long spicules.

By having a tail with a subventral stalk lacking tubercles but with several small projections at the tip, vulval flap in females, and the lateral field with four incisures, the new species resembles five known species of the genus namely: L. preissii, L. simlaensis (Negi et al., 2009), L. sinensis, L. spiflatus, L. liaoningensis, and L. unituberculus (Bajaj and Walia, 2000), but can morphologically be separated from them as follows:

It is distinguished from L. preissii by shorter female body length (898 (750–987) vs 1,185 (1,007–1,386) µm), male (696 vs 1,088 (1,000–1,218) µm), female stylet (11.8 (10.0–12.5) vs 14 (12–15) µm) and spicules (17 vs 22–28 µm).

It is distinguished from L. sinensis, by slightly shorter female body length (898 (750–987) vs 968 (914–1,064) µm), larger vulval flap (vs smaller) and longer (17 vs 14.0 (13.2–15.0) µm) and differently shaped spicules (curved vs not).

It is distinguished from L. simlaensis by shorter distance from anterior end to valve of median bulb (61.7 (53–67) vs 70–80 µm), sclerotized vagina (vs not), the nature of the stalk at the tail end of female (having 6–9 projections vs 3–5 finger-like fine processes), and spicules morphology (curved with smaller condylus and blunt rostrum vs slightly curved with large condylus and rostrum with sharp tip).

It is distinguished from L. unituberculus by more posterior SE-pore (100 (87–112) vs 82–85 µm) and nerve ring (1.2–1.9 vs one body width posterior to median bulb), the nature of the stalk at the tail end of female (having 6–9 projections vs ending to a saucer-like surface with bristle-like appendages at around, after its original drawings) and longer (17 vs 14–15 µm) and differently shaped spicules (curved vs rose-thorn).

It is distinguished from L. spiflatus by shorter female body length (898 (750–987) vs 1,150 (976–1,437) μm), male (696 vs 1,092 (905–1,235) µm), female tail (37.1 (30–44) μm, c′ = 3.2 (2.5–3.8) vs 55 (48–66) μm, c′ = 4.2 (3.8–4.9)), the nature of the stalk at the tail end of female (having 6–9 projections vs 8–12 finger-like projections), shorter (17 vs 27.3 (23.4–28.8) μm) and differently shaped spicules distal end (rounded vs truncate).

It is distinguished from L. liaoningensis by shorter female body length (898 (750–987) vs 1,462 (1,252–1,722) μm), male (696 vs 1,206 (972–1,383) µm), female tail (37.1 (30–44) μm, c′ = 3.2 (2.5–3.8) vs 62 (53–70) μm, c′ = 3.6 (3.1–4.1)), the nature of the stalk at the tail end of female (having 6–9 projections vs with two tubercles with four to six finger-like protrusions) and shorter (17 vs 28 (24–30) μm) spicules.

The two newly generated identically aligned LSU D2-D3 sequences of Laimaphelenchus africanus n. sp. (MW507183 and MW507184) were 669 and 709 nt long. The BLAST search using the longer sequence revealed the identity of this new species with currently available sequences deposited into the database, were less than 90%. A total number of 82 LSU sequences of aphelenchoidids (including two newly generated sequences of the new species), with five sequences of aphelenchids as well as classic rhabditids as outgroups, were used for inferring the LSU phylogeny. The dataset included 927 characters of which 720 character were variable. The Bayesian phylogenetic tree inferred from this dataset is presented in Fig. 4. The currently sequenced Laimaphelenchus spp. for their LSU D2-D3, except L. australis (see Discussion section), formed a maximally supported clade in this tree (the clade L) and L. africanus n. sp. appeared as an independent lineage in this clade. The pruned smaller tree as represented in Fig. 5 shows the clade L and data on stalk type, vulval flap status and lateral lines number for the currently sequenced species.

Figure 4:

Figure 5: