First report of Cactodera milleri Graney and Bird, 1990 from Colorado and Minnesota
Publié en ligne: 01 janv. 2021
Pages: 1 - 7
DOI: https://doi.org/10.21307/jofnem-2021-017
Mots clés
© 2021 Authors, published by Sciendo.
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
The genus
The Pale Potato Cyst Nematode National Survey program, which is an USDA program meant to keep under control the distribution of the Pale Cyst Nematode, is conducted nationwide by the States Department of Agriculture offices. The Minnesota Department of Agriculture is submitting regularly cysts samples to MNGDBL for identification purposes as part of the PCN program. Currently,
Cysts, white females, second-stage juveniles (J2), and eggs were obtained from Colorado (CO) and Minnesota (MN). Juveniles for morphological observations were separated from soil by sieving and Baermann funnel extraction or were live recovered from cysts from fresh roots and kept in water in watch glasses. Juveniles were fixed in 3% formaldehyde and processed to glycerin by the formalin glycerin method (Golden, 1990; Hooper, 1970). Females and some cysts were typically removed from roots after fixation for 12 hr in 3% formaldehyde solution. Photomicrographs of cyst vulval cones, females, and J2 were made with an automatic 35-mm camera attached to a compound microscope having an interference contrast system. Photomicrographs of the specimens were made with a Nikon Eclipse Ni compound microscope using a Nikon DS-Ri2 camera. Measurements were made with an ocular micrometer on a Leica WILD MPS48 Leitz DMRB compound microscope. All measurements are in micrometers unless otherwise stated.
Living nematode juveniles (J2) recovered from the cysts were examined morphologically and molecularly for species identification. Observations of morphological characters critical for identification were: cyst shape, color and nature of fenestration, cyst wall pattern, J2 stylet length, shape of stylet knobs, and shape and length of tail and hyaline tail terminus (Fig. 1) thus indicated that the specimens were
Figure 1:
Photomicrographs of second-stage juveniles (J2) and cysts of

Representative J2 from two CO isolates and three MN isolates were used for molecular confirmation of the species, using two ribosomal genes (internal transcribed spacer, ITS 1 and 2 and large ribosomal subunit, 28S), one nuclear gene (partial heat shock protein 90, Hsp90), and one mitochondrial gene (partial cytochrome oxidase I, COI). Markers were amplified with the following primer sets: TW81 and AB28 for ITS rDNA; D2A and D3B for 28S rDNA; U288 and L1110 for Hsp90; and primers JB3 and JB4.5 for COI (Table 1). DNA extraction, amplification, purification of PCR products, cloning, and sequencing were performed as described in the studies of Skantar et al. (2012) and Subbotin et al. (2017). DNA sequencing was conducted by University of Maryland Center for Biosystems Research and Genewiz, Inc. ITS rDNA and Hsp90 sequences were obtained from cloned amplicons; 28S and COI were sequenced directly from PCR products.
Primers used for molecular analysis of
Primer | Sequence (5′→3′) | Marker | References |
---|---|---|---|
D2A | ACAAGTACCGTGAGGGAAAGTTG | 28S rDNA | De Ley et al. (2005) |
D3B | TCGGAAGGAACCAGCTACTA | ||
TW81 | GTTTCCGTAGGTGAACCTGC | ITS rDNA | Joyce et al. (1994) |
AB28 | ATATGCTTAAGTTCAGCGGGT | ||
JB3 | TTTTTTGGGCATCCTGAGGTTTAT | COI mtDNA | Bowles et al. (1992) |
JB4.5 | TAAAGAAAGAACATAATGAAAATG | ||
U288 | GAYACVGGVATYGGNATGACYAA | Hsp90 | Skantar and Carta (2004) |
L1110 | TCRCARTTVTCCATGATRAAVAC |
New sequences were submitted to GenBank under the following accession numbers: ITS from CO (MT327799, MT327800) and MN (MK619682-MK619693); Hsp90 from MN (MK105547-MK105550) and CO (MT362485-MT362487, MN182650-MN182651); COI from CO (MT328830-MT328835); and 28S from MN (MK619472, MK619473), and CO (MT328175, MT328180-MT382182).
Separate alignments of ITS rDNA, Hsp90, and COI sequences were constructed using the MAFFT algorithm within Geneious v. 10.2.6 (Biomatters, Ltd., San Diego, CA). For ITS, the best-fitting model of nucleotide substitution, General Time Reversible with Gamma distributed rates with Invariant sites (GTR + I + G), was estimated using jModelTest based on the Akaike information criterion. Phylogenetic relationships were estimated by Bayesian inference (BI) on the CIPRES Science Gateway (
Figure 2:
Phylogenetic relationships of

Figure 3:
Phylogenetic relationships of

Figure 4:
Phylogenetic relationships of

Figure 5:
Phylogenetic relationships of

Measurements of second-stage juveniles from Colorado (
The ITS rDNA clone sequences from the CO population varied 2 bp from each other, while differences among MN population clones ranged from 4 to 14 bp. The exceptions were one MN clone (MK619692) and the
28S rDNA sequences from
Partial Hsp90 sequences were aligned with selected sequences from other
COI sequences from 2011 and 2019 CO isolates were identical to each other and varied from
Based upon this collective morphological and molecular data, we identify this isolate as