Lymphoedema, swelling due to excess accumulation of the protein-rich lymph in the tissues, is caused by inadequate lymph reabsorption or when the lymphatic vessels are absent or function defectively.1 Primary lymphoedema is affecting approximately 1.15/100,000 of less than 20 years of age population.2 Affected individuals suffer from chronic lymphoedema and are at greater risk for developing infections, including bacterial infection of the skin and underlying tissue (cellulitis) or infection of the lymphatic vessels (lymphangitis).3 They are also at a greater risk than the general population for developing a malignancy, at the affected site. The most common malignancy associated with the affected area is the angiosarcoma4-6 (the condition called the Stewart-Treves syndrome), however, also other malignancies, the basal cell carcinoma, squamous cell carcinoma, melanoma, Kaposi sarcoma, Merkel cell carcinoma, and several cutaneous lymphomas6 can occur, and are probably due to the immunocompromised district of the affected area or because of the environment rich in growth factors due to the formation of collateral lymphatic vessels.6 Therefore, identification (also with the aid of genetic testing) and monitoring of patients with chronic lymphoedema (no matter the etiology) should be performed periodically to identify and treat malignant changes that can develop in the affected areas.6
The clinical presentation of primary lymphoedema is very variable and varies in the age of onset, the edematous part of the body affected, associated anomalies and different inheritance patterns.7 The most recent classification of primary lymphoedema has been developed as a diagnostic algorithm, proposed by Connell in 20107 and 20138, and is based first on different clinical presentations and second on the genetic findings.
The genetic basis of primary lymphoedema are mutations in five causative genes that also underlie specific forms of the disease9,10 namely:
In patients with LDS, lymphoedema of both lower limbs, that typically starts in late childhood or during puberty10,15, and varicose veins are accompanied by extra eyelashes (known as distichiasis) and also other comorbidities, such as ptosis (35% of patients), congenital heart disease (8%) and cleft palate (3%).7,8,15 In the majority (95%) of patients with LDS, mutations in the
Besides causing LDS,
Three family members, a 39-year-old woman, her 74-year-old father and 14-year-old son, have been diagnosed with primary lymphoedema at the Dermatovenerological Clinic, University Clinical Centre Ljubljana.
The 74-year-old has lymphoedema of both lower limbs stage III with fibrosis and sclerosis with only some small reticular veins present and genital edemas with lymphatic cysts. The disease started when the patient was 11 years old. The patient does not have distichiasis, ptosis, and cleft palate. There is no known history of lymphoedema in the patient’s family and his wife, who had died, also did not have any history of lymphoedema. The patient has suffered a myocardial infarction in 2007 and had a mitral and a tricuspid valve replacement. Patient is being treated with short-stretch bandages and manual lymph drainage and in the maintenance phase with compression garments (bermuda shorts, and flat knitted thigh high stocking class III). Before therapy, he had suffered several erysipelas which have not reoccurred after regular therapy for lymphoedema.
The 39-years-old daughter has lymphoedema stage III of both lower limbs without genital involvement, with the disease onset at age 9. The patient, like her father, also does not have distichiasis, ptosis or cleft palate. She has varicose veins present on both of her legs. Her husband does not have lymphoedema. She is being treated with flat knitted thigh high stocking class III. Again, she had suffered several erysipelas which were stopped after regular therapy for lymphoedema. She has three children.
In her son, lymphoedema stage II of both lower limbs first occurred at the age of 13. He has no other pathological clinical findings. He is being treated with round knitted stockings class II. He has not suffered any erysipelas.
Both her daughters aged 9 and 6 years have no symptoms and signs of lymphoedema. Age, gender, and detailed clinical characteristics of the recruited subject are presented in Table 1.
Clinical findings of family members with primary lymphoedema
Patients | |||||
---|---|---|---|---|---|
Gender | M | F | M | F | F |
Age (years) | 74 | 39 | 14 | 9 | 6 |
Lymphoedema | Yes | Yes | Yes | No | No |
Lower limbs | Yes = whole lower limbs |
Yes = whole lower limbs |
Yes = calves only |
No | No |
Genital | Yes | No | No | No | No |
Distichiasis | No | No | No | No | No |
Onset (years) | 11 | 9 | 13 | / | / |
Varicose veins | Yes | Yes | No | No | No |
Ptosis | No | No | No | No | No |
Cleft palate | No | No | No | No | No |
Congenital heart disease | No | No | No | No | No |
c.867insA | c.867insA | c.867insA | No | c.867insA | |
Cellulitis | Yes | Yes | No | No | No |
Yellow nails | No | No | No | No | No |
F = female; M = male
The study was approved by the Slovenian national ethics committee (number: 157/07/10) and all participants gave their informed written consent.
Genomic DNA was extracted from EDTA-containing whole blood samples using a QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The detection of
Primer sequences and conditions used to amplify and sequence the
Name of primer | Sequence (5˘-3˘) | Annealing temp (°C) | Product size (bp) | DMSO % | MgCl2 mM |
---|---|---|---|---|---|
FOXC2-1F = Primer pairs from27 |
TCTGGCTCTCTCGCGCTCT | 58 | 476 | 6 | 1.5 |
FKHL14-2R | AGTAACTGCCCTTGCCGG | ||||
FOXC2-2F = Primer pairs from27 |
ACCGCTTCCCCTTCTACCGG | 60 | 519 | 10 | 1.5 |
FOXC2-2R | TCATGATGTTCTCCACGCTGAA | ||||
FKHL14-4F = Primer pairs from27 |
GAAGGTGGTGATCAAGAGCG | 60 | 496 | 6 | 1.5 |
FOXC2-3R | GAGGTTGAGAGCGCTCAGGG | ||||
FOXC2-4F = Primer pairs from27 |
CTGGACGAGGCCCTCTCGGAC | 61 | 464 | 10 | 1.5 |
FOXC2-4R | GGAGGTCCCGGGACACGTCA | ||||
FOX_5P_1F = Primer pairs from28 |
GCCGACGGATTCCTGCGCTC | 61 | 378 | 10 | 1.5 |
FOX_5P_1R | CCGCTCCTCGCTGGCTCCA | ||||
FOX_5P_2F = Primer pairs from28 |
CCGATTCGCTGGGGGCTTGGAG | 61 | 607 | 6 | 1.5 |
FOX_5P_2R | GCGGGCTGGTGGTGGTGGTAGG | ||||
FOX_3P_1F = Primer pairs from28 |
CAACGTGCGGGAGATGTTCAAC | 61 | 464 | 10 | 1.5 |
FOX_3P_1R | CACAGCACAGCCGTCCTGGTAG | ||||
FOX_3P_2F = Primer pairs from26 |
TACTGACGTGTCCCGGGACC | 61 | 468 | 6 | 1.5 |
FOX_3P_2R | CCACACATTTGTACAGCACGGTTG |
The clinical detail of all five patients are shown in Table 1.
In all affected members of the described three generation family with lymphoedema of lower limbs without distichiasis the same mutation in Pedigree of the family with new mutation in Figure 1
Since the discovered mutation was not previously reported we additionally evaluated this mutation in 182 normal controls. None of the controls harbored the mutation, which further supports the causative nature of the mutation.
Up to date only one lymphedema family with
In all three patients of our family, lymphoedema developed between the age of 9 and 13. The onset of lymphoedema in literature is typically during puberty or in late childhood.7,26,30 In the 6 years old girl without clinical manifestations of lymphoedema with mutation in
Mutations in the
The
In conclusion, we identified a causative previously unreported insertion in