Taeniidae is the largest family of flatworms representing the order Cyclophyllidea. It includes many tapeworms with medical and veterinary importance (Qingling
Two major species of tapeworms of medical, and public health importance are
Polymerase chain reaction (PCR) is a highly sensitive approach to target mitochondrial DNA (mtDNA) sequences for both
Mazandaran province (36° 33′ 56″ N 53° 03′ 32″ E) is placed at the northern part of Iran on the southern coast of the Caspian Sea (Fig. 1). It covers an area of approximately 23,842 km2, and its population is 2,922,432. It has moderate and subtropical climate with a relative humidity of 70 % – 100 %, average temperature of 10 – 35 °C, and an annual rainfall of 800 – 1200 mm. The area is geographically classified into the coastal plains and the mountainous areas of the Alborz Mountain Range. The ecosystems of this province are diverse and comprise of many plains, prairies, and forests (Youssefi
Fecal specimens from 100 domestic dogs (male: 56; female: 44, and ages <12 month: 21; ≥ 12 month: 79) were collected from the different areas of Mazandaran province, in the north of Iran, from January to September 2013. Each sample consisted of approximately 30 g of fresh stool collected from the rectum of domestic dogs, and was accompanied by information about the gender and age of the dog . The fecal samples were placed in labeled “ziploc” bags, and stored at -80 °C for at least seven days to reduce the risk of laboratory infection by inactivating any
To detect taeniid eggs, fecal samples from 100 domestic dogs were investigated by zinc chloride flotation and sieve method. Approximately 30 g of fresh stool was collected from the domestic dogs and 5 g of each sample was weighted and stirred into 50 ml distilled water until completely dispersed. The suspension was passed through four layers of gauze to remove large particles. The suspension was transferred into a 50 ml Falcon tube, and centrifuged at 1000 ×
The DNA of taeniid eggs (samples with positive finding of eggs of
Multiplex PCR was performed on the DNA from eggs as described previously (Trachsel,
The applied primers characteristics for multiplex PCR
Parasite | Target | Name | Primer sequence (5′-3′) | Amplicon size (bp) |
---|---|---|---|---|
Cesti | TGCTGATTTGTTAAAGTTAGTGATC | 395 bp | ||
Cest2 | CATAAATCAATGGAAACAACAACAAG | |||
rrnS | Cest4 | GTTTTTGTGTGTTACATTAATAAGGGTG | 117 bp | |
Cest5 | GCGGTGTGTACMTGAGCTAAAC | |||
rrnS | Cest3 | YGAYTCTTTTTAGGGGAAGGTGTG | 267 bp | |
Cest5 | GCGGTGTGTACMTGAGCTAAAC |
The data were analyzed using the SPSS 15 software. The chisquare test (χ2 test) was used to determine associations between the prevalence of Taeniid eggs and the dogs’ age and gender.
Taeniid eggs were observed in 24 % (N = 24) of the examined dogs’ fecal samples in the north of Iran. Although male dogs revealed a higher infection rate of Taeniid eggs (24.9 %) compared to female subjects (22.7 %) and dogs aged less than 12 month showed a higher infection rate (27.4 %) than those aged more than 12 month (22.6 %), no statistically significant differences were observed in infection rates due to gender and age of examined individuals (P > 0.05).
The results of multiplex PCR on 24 DNA samples obtained from taeniid eggs for the amplification of a 117 bp fragment of rrnS indicated that 50 % (N=12) of the domestic dogs tested were infected with
Prevalence of infectivity of domestic dogs in north of Iran using multiplex PCR from DNA of taeniid eggs from faecal samples according to sex and age (N=100)
Infection | Sex | Age | Total | ||
---|---|---|---|---|---|
Male | Female | 12 month> (n: 21) | 12 month ≤(n: 79) | ||
8.9 % (5) | 15.9 % (7) | 14.2 % (3) | 11.3 % (9) | 12 % (12) | |
12.5 % (7) | 6.8 % (3) | 9.5 % (2) | 10.1 % (8) | 10 % (10) | |
0 | 0 | 0 | 0 | 0 | |
Mixed infection | 3.5 % (2) | 0 | 4.7 % (1) | 1.2 % (1) | 2 % (2) |
>0.05 | >0.05 | ||||
Total | 24.9 % (14) | 22.7 % (10) | 27.4 % (6) | 22.6 % (18) | 24 % (24) |
In the current study, combining sieving and multiplex PCR, we show that 14 % of the examined samples were infected by
Iran is considered an important endemic area of CE, and a wide range of intermediate hosts is commonly infected with
An investigation in Lithuania showed significant differences between a modified McMaster method and the sieving-flotation technique (Bružinskaitė
In the current study, optimized multiplex PCR was used as it is highly sensitive. Single taeniid eggs could be detected, which is in accordance with other single-target, PCR-based tests (Abbasi
In conclusion, Iran is endemic for CE, and a high prevalence of
Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/ or submission, redundancy, etc.) have been completely observed by the authors.