Morphological and molecular characterization of Xiphinema species from Shenzhen, China

Soil samples were collected from the rhizosphere at a depth of 15 – 30 cm of different plants, namely Acacia acacia, Taiwan acacia, Blechnoid, Lychee in Tianxinshan and Awn dichotoma in Yangmeikeng environmental monitoring sites. Ten nematode populations from the rhizosphere of five plants in two environmental monitoring sites, Shenzhen, China, were presented in Table 1. Nematodes were extracted by a sieving and decanting method (Brown & Boag, 1988). Specimens were heat-killed, fixed in 3 % formaldehyde and processed to glycerin by the formalin-glycerin method (Hooper, 1970; Golden, 1990). Specimen preparation and measurements were as described in Golden & Birchfield (1972). Measurements of nematodes were performed with the aid of a camera lucida and a stage micrometer. The morphometric data were processed using Excel software (Ye, 1996). Photomicrographs were taken with a Leica video camera (DFC490) fitted on a Leica microscope (DM4000B), and edited using Adobe Photoshop CS5. Morphological identification of specimens for Xiphinema was done using the polytomous keys provided by Lamberti et al. (2000, 2004) and Loof & Luc (1990), with corresponding species descriptions.

DNA extraction, amplification and sequencing For each population, three females were hand-picked into distilled water for DNA extraction, amplification, and sequencing. They were placed into 50 μl of worm lysis buffer (WLB) containing Proteinase K for DNA extraction (Williams et al., 1992). DNA samples were stored at –20°C until used as a PCR template.

The primers for small subunit 18S amplification and DNA sequencing were forward primer 18S965 (5’ GGCGATCAGATAC CGCCCTAGTT 3’) and reverse primer 18S1573R (5’ TACAAAGGGCAGGGACGTAAT 3’) (Mullin et al., 2005). Primers for large subunit 28S amplification and DNA sequencing were forward primer D2a (5’ ACAAGTACCGTGAGGGAAAGTTG 3’) and reverse primer D3b (5’ TGCGAAGGAACCAGCTACTA 3’) (Nunn, 1992). The 25 μl PCR was performed using TaqMix DNA polymerase (Guangzhou Dongsheng Biotech Ltd., Guangzhou, China) according to the manufacturer’s protocol. The thermal cycler program for PCR was as follows: denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 94 °C with 30 s; annealing at 55 °C for 45 s, and extension at 72 °C for 2 min. A final extension was performed at 72 °C for 10 min (Ye et al., 2007).

PCR products were cleaned using an EZ Spin Column DNA Gel Extraction Kit (Bio Basic Inc., Markham, Ontario, Canada) according to the manufacturer’s protocol before being sequenced by Shanghai Sangon Biological Engineering Technology and Service Co., Ltd. (Shanghai, China) using an ABI PRISM 3730 sequencing system.

Phylogenetic analysis: The nematode sequences from this project were deposited in GenBank. We used DNA sequences with the highest matches with our populations from the GenBank database for phylogenetic analysis. DNA sequences were aligned using ClustalW (http://workbench.sdsc.edu, Bioinformatics and Computational Biology Group, Department of Bioengineering, UC San Diego, San Diego, CA, USA). The model of base substitution in the 28S rDNA sets was evaluated using MODELTEST version 3.06 (Posada & Crandall, 1998). The Akaike-supported model (GTR), the proportion of invariable sites (I), and the gamma distribution shape parameters and substitution rates (G) were used in phylogenetic analyses. Bayesian analysis was performed to confirm the tree topology for each gene separately using MrBayes 3.1.0 (Huelsenbeck & Ronquist, 2001) running the chain for 106 generations and setting the ‘burn in’ at 1000. We used MCMC (Markov Chain Monte Carlo) methods within a Bayesian framework to estimate the posterior probabilities of the phylogenetic trees (Larget & Simon, 1999) using the 50 % majority-rule.

Morphometrics of females of ten populations of Xiphinema are presented in Table 2. Four populations (SZX1301 – SZX1304) of X. hunaniense are identical each other. All five populations of X. americanum s.l. (SZX1306 – SZX1310) showed little variation at morphometrics and molecular characteristics, thus considered different geographical populations belonging to the same species. Xiphinema hunanienseWang & Wu, 1992 (Fig. 1, Tables 1 & 2) Female: Body 1810 – 2400 μm long, tapering slightly towards anterior and tail region, posterior end arcuate ventrally when heat-killed. Body cuticle smooth. Lip region 10 – 12 μm in diam., slightly offset from body profile. Amphids stirrup-shaped, with slitlike apertures. Stylet 173 – 193 μm long. Guide ring 86 – 108 μm from anterior end. Pharynx typical of genus. Vulva a transverse slit, anterior, occupies 23 % – 28 % of total body length, vagina thick-walled, occupying up to 50 % of body width. Reproductive system monodelphic, with a posterior reflexed gonad. Uterus short and undifferentiated, “Z”-organ absent. Tail dorsally conoid, slightly convex dorsally and concave ventrally, with a digitate, elongated peg (11 – 20 μm long), with three caudal pores on each side of tail (one on each at beginning of tail terminus, the other two on the dorsal side near anus).

Fig. 1.

Male: Not found.

The morphology and morphometrics of four studied populations (SZX1301 – SZX1304) of X. hunaniense agreed with the description of type populations except for a lower a (39.7 – 52.7 vs 51.0 – 57.0) and c (37.1 – 51.6 vs 53.0 – 63.0) values (Wang & Wu, 1992). A revised polytomous key code sensu Loof & Luc (1990) for X. hunaniense identification is: A1-B4-C4-D4-E1-F2-G2-H2-I3-J4-K2-L1.

(Fig. 2, Tables 1 & 2)

Fig. 2.

Female: Body 1108-2100 μm long, cylindrical, straight or ventrally arcuate to form an open “C” shape when heat-killed. Lip region continuous with the rest of the body or offset from body profile by a depression. Stylet 182 – 212 μm long. Guide ring 109 – 120 μm from anterior end. Reproductive system monodelphic, with an anterior reflexed gonad. Vulva anteriorly located at 26 % – 29 % of total body length, vagina 1/3 to 1/2 body diam. long, posteriorly obliquely bent. Tail broadly conoid ending with a well-developed axial peg, 8 – 12 μm long. Four caudal pores present on each side of tail.

Male: Not found.

Xiphinema brasiliense population (SZX1305) agreed with type (Lordello, 1951) and other populations (Cordero, 2003), except for a higher b and c value (5.50 vs 5.05 and 41.60 vs 24.55) (Lordello, 1951), but lie within the ranges of those reported by Cordero (2003). A revised polytomous key code sensu Loof and Luc (1990) for X. brasiliense identification is: A1-B4-C5-D5-E1-F2-G2(3)-H1(2)-I3-J5-K?-L1.

(Fig. 3, Tables 1 & 2)

Fig. 3.

Female: Body 1644 – 2110 μm in length, cylindrical, tapering gradually towards the anterior extremity, and more abruptly posteriorly in the tail region, ventrally arcuate to form a closed “C” shape when heat-killed. Cuticle finely transversely striated. Lip region broadly rounded, set off from the rest of body by a depression, 10 – 11 μm in diam. Amphids large, stirrup-shaped, with wide aperture, as a straight transverse slit. Stylet 132 – 153 μm long, basal flanges 7.5 – 9.5 μm wide. Guiding ring 69 – 89 μm from anterior end. Pharynx dorylaimoid with the anterior part tubular, bearing a strongly refringent mucro at 48 – 54 μm from the base of the odontophore, pharyngeal basal bulb containing three nuclei, nucleus of dorsal pharyngeal gland located at 25 % of the length from the beginning of basal bulb, and two ventro-sublateral nuclei situated at 50 % of the bulb. Oesophago-intestinal valve heart-shaped. Reproductive system amphidelphic with reflexed branches about equally developed. Vulva slit-like, situated in mid-body region. Vagina 11 – 15 μm in length, occupying about 1/3 of the corresponding body diam., pars proximalis vaginae 5 – 6 μm long, pars distalis vaginae 7 – 10 μm long. Uteri long, 35 – 45 μm, not clearly separated from the oviduct, without spermatheca. Rectum length 1/2 of the body diam. at anus. Tail short conoid, with rounded terminus and four lateral pores.

five studied populations were classified as X. americanum s.l. due to limited diagnostic morphological characters and DNA data.

The codes of the Chinese Xiphinema americanum s.l. populations and close species using both X. americanum-group polytomous identification keys (Lamberti et al., 2000; Lamberti et al., 2004) were presented in Tables 3, 4. The codes of the Chinese X. americanum s.l. populations are: A2, B2, C2, D1, E1(2), F1, G2, H2(3), I2, J2 sensu Lamberti et al. (2000) and A3(4), B2, C2, D2, E2, F1, G2, H2, I2 sensu Lamberti et al. (2004). Further, after sorting the codes with other data in the keys the Chinese populations showed identical numbers to some other species in X. americanum-group.

The 18S rDNA (633 – 796 bp) and 28S D2–D3 expansion segment (773 – 860 bp) were amplified and sequenced. Sequences of the rDNA were compared using blastN search from a diverse collection of Xiphinema species from GenBank and were used to construct phylogenetic trees with highest match sequences.

The alignment for the partial 18S rDNA included 67 sequences. Four studied populations (KP793036 – KP793039) of X.

Male: Not found.

A morphometric analysis of five studied populations of X. americanum s.l. (SZX1306 – SZX1310) revealed that specimens from these populations differed from Cobb’s paratypes of the X. americanum by having a longer body (1644 – 2106 vs 1400 – 1500 μm), a lower a value (38 – 50 vs 50 – 57), a higher c value (56 – 85 vs 45 – 54), a lower c’ value (0.9 – 1.4 vs 1.7 – 2.0), a longer odontostyle (83 – 108 vs 65 – 73 μm), a longer odontophore (49 – 58 vs 41 – 46 μm) and a more posterior guide ring (71 – 89 vs 51 – 55 μm) (Lamberti & Golden, 1984), from X. incognitum by having a smaller lip (10.0 – 11.2 vs 11.0 – 13.0 μm), from X. diffusum by having a smaller lip (10.0 – 11.2 vs 11.0 – 13.0 μm), a more posterior guide ring (69.3 – 88.9 vs 60.0 – 64.0 μm), from X. taylori by having a shorter (1644 – 2106 vs 2100 – 2500 μm), a higher c’ value (0.9 – 1.4 vs 0.7 – 0.8) and a longer tail (23.9 – 33.2 vs 19.5 – 22.0 μm), from X. parabrevicolle by having a higher c’ value (0.9 – 1.4 vs 0.7 – 0.8), a smaller lip (10.0 – 11.2 vs 12.5 – 14.0 μm) (Gutiérrez-Gutiérrez et al. 2012), from X. brevicolle by having a shorter stylet (137 – 143 vs 144 – 173 μm) (Lordello & Costa 1961; Lamberti et al. 1991; Luc et al. 1998), a lower b value (5.3 – 7.7 vs 7.0 – 10.5) (Lordello & Costa 1961). Nevertheless, these hunaniense from China had 100 % identities (647/647=100 %) based on alignments of the sequences of 18S rDNA. No 18S sequence of X. hunaniense was available for comparison in Gen-Bank. Alignment of the 18S sequences from the studied population (KP793040) of X. brasiliense from China with one Brazil population of X. brasiliense (AY297836) from GenBank revealed 99 % identity (688/694=99 %). The sequences of 18S rDNA from five studied populations (KP793041 – KP793045) of X. americanum s.l. from China shared 100 % identities (633/633=100 %). These sequences are also identical to four other populations from Brazil (AY297822), Czech Republic (HM163212), Belgium (AY580057) and Japan (AB604340). However, the sequenced 18S fragments are only 633 – 796 bp without sufficient divergent sites to examine the phylogenetic relationships among dagger species, no significant clades were generated with strong support, thus the 18S tree is presented. The alignment for the D2–D3 of 28S rDNA included 93 sequences. The sequences of 28S rDNA from four studied populations (KP793046 – KP793049) of X. hunaniense shared 99 % identities with 2 nucleotide differences. The alignment of the 28S sequences from these four studied populations with other five populations of X. hunaniense (EF026090, EF188839, EF188840, EF188841, KF290564) from GenBank revealed 98 % – 99 % identities with 6 – 14 nucleotide differences. The blastn search of the 28S sequence of the Chinese population (KP793050) of X. brasiliense revealed a 99 % match (763/766=99 %, 3 nucleotide differences) with one Brazilian population of X. brasiliense (AY601616) from GenBank. Five studied populations (KP793051 – KP793055) of X. americanum s.l. shared 99 % – 100 % identities with 0 – 9 nucleotide differences. The alignment of the 28S sequences from these five studied populations with 11 populations of X. brevicolle (AB635401, AB675667, AB675668, AY580057, AY601601, AY601604, AY601605, FM211649, HM163209, HQ184473, KF430800) and some other species such as X. lambertii (HM163211), X. diffusum (AY601600), X. taylori (AY601602), etc. from GenBank revealed 98 % – 99 % identities with 10 – 20 nucleotide differences.

The phylogenetic tree inferred from D2–D3 of the 28S rDNA (Fig. 4) using Longidorus vineacola Ye & Robbins, 2003 and L. helveticus Lamberti, Kunz, Grunder, Molinari, De Luca, Agrostinelli & Radicci, 2001 as outgroups suggested that: i) all the selected xiphinematids are in a monophyletic clade in relation to L. vineacola with 100 % pp; ii) two distinct clades of Xiphinema species are highly supported (pp=100 %), representing X. americanum-group and non-X. americanum-group. In X. americanum-group, seven populations (HM921393, HM921356, KJ802889, JQ990031, JQ990032, JQ990036, JQ990040) are in a clade and 35 other populations including five studied ones of X. americanum s.l. (KP793051 – KP793055) are in another clade with 100 % support; iii) five studied populations of X. americanum s.l. are in a monophyletic clade with 100 % support, and are in a highly-supported (pp=100 %) monophyletic clade with 16 other populations of Xiphinema, and they are sister to X. parabrevicolle (JQ990042); iv) four studied populations of X. hunaniense (KP793046 – KP793049) and the population of X. brasiliense (KP793050) are clustered with other members of non-X. americanum-group, and these two species are in two separate clades; v) four studied populations of X. hunaniense are in a highly-supported (pp=100 %) monophyletic clade with five other populations of X. hunaniense (EF026090, EF188839, EF188840, EF188841, KF290564) from GenBank, and they are sister to X. lupini (KC567183, HM921352) and X. turcicum (KC567185); v) the studied population X. brasiliense (KP793050) is in a highly-supported (pp=100 %) clade with the Brazilian population of X. brasiliense (AY297836), and they are in a highly-supported (pp=100 %) clade with 12 other species (X. nuragicum, X. pyrenaicum, X. hispanum, X. adenohystherum, X. sphaerocephalum, X. italiae, X. zagrosense, X. granatum, X. cohni, X. gersoni, X. israeliae, X. barense) from GenBank.

Fig. 4.