Acceso abierto

Evaluating the Sensitivity of Different Molecular Techniques for Detecting Mycobacterium tuberculosis Complex in Patients with Pulmonary Infection

Hassan A. Hemeg
Hassan A. Hemeg
, 
Hamzah O. Albulushi
Hamzah O. Albulushi
, 
Hani A. Ozbak
Hani A. Ozbak
, 
Hamza M. Ali
Hamza M. Ali
, 
Emad K. Alahmadi
Emad K. Alahmadi
, 
Yahya A. Almutawif
Yahya A. Almutawif
, 
Sari T. Alhuofie
Sari T. Alhuofie
, 
Rana A. Alaeq
Rana A. Alaeq
, 
Areej A. Alhazmi
Areej A. Alhazmi
, 
Mustafa A. Najim
Mustafa A. Najim
 y 
Ahmed M. Hanafy
Ahmed M. Hanafy
   | 16 dic 2023
Polish Journal of Microbiology's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Article Category: ORIGINAL PAPER
Publicado en línea: 16 dic 2023
Páginas: 421 - 431
Recibido: 20 jun 2023
Aceptado: 04 oct 2023
DOI: https://doi.org/10.33073/pjm-2023-040
Palabras clave
© 2023 Hassan A. Hemeg et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Polymerase chain reaction amplification of the specific 130 bp fragments with the IS6110 primer pair (panel a) and the specific 152 bp fragments with the mtp40 primer pair (panel b). Lanes 2–36 of (panel a) are representative amplified PCR products with the IS6110 primers from selected sputum samples. Lanes 5, 11, 12, 16, 17, 20, 23, 24, 25, 29, and 34 of (panel b) are representative amplified PCR products with the mtp40 primers from selected sputum samples. Lanes 2, 14, 26, 27, 28, and 30 represent the samples not amplified by the mtp40 primer pair. Lanes M (panels a and b) represent the 100-bp DNA ladder.
Polymerase chain reaction amplification of the specific 130 bp fragments with the IS6110 primer pair (panel a) and the specific 152 bp fragments with the mtp40 primer pair (panel b). Lanes 2–36 of (panel a) are representative amplified PCR products with the IS6110 primers from selected sputum samples. Lanes 5, 11, 12, 16, 17, 20, 23, 24, 25, 29, and 34 of (panel b) are representative amplified PCR products with the mtp40 primers from selected sputum samples. Lanes 2, 14, 26, 27, 28, and 30 represent the samples not amplified by the mtp40 primer pair. Lanes M (panels a and b) represent the 100-bp DNA ladder.

Fig. 2.

Multiplex-PCR results in 2% agarose gel: the 392 bp product corresponds to embB codon (306); the 335 bp to katG (315) codon, the 270 bp to (–15) promoter region of mab A -inh A; the 218 bp, 185 bp, and 170 bp products correspond to rpoB codons (516, 526 and 531), respectively. Results show a nonspecific small-size product that links to the amplification of the 170 bp fragment. Lanes M (panels a and b) 100-bp DNA ladder. Lanes 2, 5, 11, 27, 28, and 29 represent sputum samples’ DNA with no mutation at the codons under study. Lanes 12-26 (panel a) and lane 48 (panel b) show embB codon 306 mutation (ethambutol). Lanes 30, 34, 36 (panel a) show rpoB codon 526 mutation (rifampin). Lanes 37, 41, 42, 44, 46 and 47 (panel b) show mutations with both the rpoB codon 531 (rifampin) and embB codon 306. Lanes 40 and 43 show mutation in rpoB codon 531 (rifampin) only.
Multiplex-PCR results in 2% agarose gel: the 392 bp product corresponds to embB codon (306); the 335 bp to katG (315) codon, the 270 bp to (–15) promoter region of mab A -inh A; the 218 bp, 185 bp, and 170 bp products correspond to rpoB codons (516, 526 and 531), respectively. Results show a nonspecific small-size product that links to the amplification of the 170 bp fragment. Lanes M (panels a and b) 100-bp DNA ladder. Lanes 2, 5, 11, 27, 28, and 29 represent sputum samples’ DNA with no mutation at the codons under study. Lanes 12-26 (panel a) and lane 48 (panel b) show embB codon 306 mutation (ethambutol). Lanes 30, 34, 36 (panel a) show rpoB codon 526 mutation (rifampin). Lanes 37, 41, 42, 44, 46 and 47 (panel b) show mutations with both the rpoB codon 531 (rifampin) and embB codon 306. Lanes 40 and 43 show mutation in rpoB codon 531 (rifampin) only.

Fig. 3.

Rifampin and ethambutol resistance correlated with mutations and their frequency.
Rifampin and ethambutol resistance correlated with mutations and their frequency.

Fig. 4.

Detailed Venn diagrams showing the number of shared and unique RIF-sensitive MTBC-positive samples (panel a) and RIF-resistant MTBC-positive samples (panel b) among the GeneXpert MTB/RIF, phenotypic culture-based DST, and multiplex PCR assays, and EMB-sensitive MTBC-positive samples (panel c) and EMB-resistant MTBC-positive samples (panel d) among phenotypic culture-based DST and multiplex PCR methods. The numbers under each method in brackets represent the totals detected using that method.
Detailed Venn diagrams showing the number of shared and unique RIF-sensitive MTBC-positive samples (panel a) and RIF-resistant MTBC-positive samples (panel b) among the GeneXpert MTB/RIF, phenotypic culture-based DST, and multiplex PCR assays, and EMB-sensitive MTBC-positive samples (panel c) and EMB-resistant MTBC-positive samples (panel d) among phenotypic culture-based DST and multiplex PCR methods. The numbers under each method in brackets represent the totals detected using that method.

The distribution of mutations associated with rifampin, ethambutol, and isoniazid resistance among MTBC DNA-positive sputum samples.

Genes rpoB embB katG inhA rpoB + embB
Mutation codons 516 526 531 306 315 (-15) 526 531
No. of isolates 0 3 8 19 0 0 3 6
Frequency (%) 0 11.1 29.6 70.4 0 0 11.1 22.2

Comparisons between GeneXpert MTB/RIF and culture-based DST with MAS-PCR in detecting drug sensitivity and resistance among MTBC DNA-positive clinical samples.

Sample number MAS-PCR GeneXpert Cult-Bas-DST
RIF EMB INH RIF RIF EMB INH
  2 S S S S S S S
  5 S S S S S S S
11 S S S S S S S
12 S R S S S S S
17 S R S S S S S
20 S R S S S S S
23 S R S S S S S
24 S R S S S S S
25 S R S S S S S
26 S R S S S S S
27 S S S S S S S
28 S S S S S S S
29 S S S S S S S
30 R S S S S S S
34 R S S R R S S
36 R S S S S S S
37 R R S S S S S
40 R R S R R R S
41 R R S S S S S
42 R R S S S S S
43 R R S S S S S
44 R R S S S S S
46 R R S R R R S
47 R R S R R R S
48 S R S S S R S

PCR primers for amplifying Mycobacterium tuberculosis complex DNA and MAS-PCR primers for the detection of INH, RIF, and EMB resistance mutations in M. tuberculosis.

Gene Primer sequence (5’-3’) PCR product size Purpose
IS6110 F: CCTGCGAGCGTAGGCGTCGG 123 bp M. tuberculosis complex detection (Sinha et al. 2017)
R: CTCGTCCAGCGCCGCTTCGG
mtp40 F: CTGGTCGAATTCGGTGGAGT 152 bp
R: ATGGTCTCCGACACGTTCGAC
katG 315 (OF) F: ATACGACCTCGATGCCGC 335 bp Isoniazid resistance detection (Yang et al. 2005; Sinha et al. 2019)
(5R) R: GCAGATGGGGCTGATCTACG
inhA (P15) F: GCGCGGTCAGTTCCACA 270 bp
(PF2) R: CACCCCGACAACCTATCG
rpoB (516) F: CAGCTGAGCCAATTCATGGA 218 bp185 bp170 bp Rifampin resistance detection (Yang et al. 2005; Sinha et al. 2019)
(526) F: CTGTCGGGGTTGACCCA
(531) F: CACAAGCGCCGACTG TC
RIRm (–) R: TTG ACCCGCGCGTACAC
embB embB306 F: GGCTACATCCTGGGCATG 392 bp Ethambutol resistance detection (Yang et al. 2005; Sinha et al. 2019)
embBR2 R: GAGCCGAGCGCGATGAT
eISSN:
2544-4646
Idioma:
Inglés
Calendario de la edición:
4 veces al año
Temas de la revista:
Life Sciences, Microbiology and Virology
RSS Feed de revista