Prevalence and Biological Characteristics of Listeria Species Isolated from Livestock and Poultry Meat in Gansu Province, China
, , , , , , , , y
24 mar 2023
Acerca de este artículo
Categoría del artículo: ORIGINAL PAPER
Publicado en línea: 24 mar 2023
Páginas: 11 - 20
Recibido: 06 oct 2022
Aceptado: 27 dic 2022
DOI: https://doi.org/10.33073/pjm-2023-002
Palabras clave
© 2023 ZHIJIE DONG et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Primer information_
Gene target | Primer sequence (5’-3’) | Product size |
Application |
---|---|---|---|
GCTGAAGAGATTGCGAAAGAAG | 370 | ||
CAAAGAAACCTTGGATTTGCGG | |||
TGTCCAGTTCCATTTTTAACT | 420 | ||
TTGTTGTTCTGCTGTACGA | |||
CGCATTTATCGCCAAAACTC | 749 | ||
TCGTGACATAGACGCGATTG | |||
AGGGCTTCAAGGACTTACCC | 691 | For the identification of |
|
ACGATTTCTGCTTGCCATTC | |||
AGGGGTCTTAAATCCTGGAA | 909 | For the identification of |
|
CGGCTTGTTCGGCATACTTA | |||
AGCAAAATGCCAAAACTCGT | 471 | For the identification of |
|
CATCACTAAAGCCTCCCATTG | |||
AGTGGACAATTGATTGGTGAA | 597 | For the identification of |
|
CATCCATCCCTTACTTTGGAC | |||
AGAGTTTGATCCTGGCTCAG | 1,500 | Used for cluster analysis | |
GGTTACCTTGTTACGACTT |
Statistic of data on the prevalence of Listeria spp_ according to regions and sample categories_
Number of samples | |||||
---|---|---|---|---|---|
Different regions | |||||
Lanzhou City | 298 | 7 (2.4 |
30 (10.1 |
2 (0.7 |
39 (13.1 |
Qingyang City | 275 | 6 (2.2 |
95 (34.6 |
4 (1.5 |
105 (38.2 |
Jiuquan City | 129 | 1 (0.8 |
2 (1.6 |
0 (0 |
3 (2.3 |
Dingxi City | 400 | 0 (0 |
6 (1.5 |
0 (0 |
6 (1.5 |
Zhangye City | 285 | 0 (0 |
17 (6.0 |
4 (1.4 |
21 (7.4 |
Total | 1,387 | 14 (1.0) | 150 (10.8) | 10 (0.7) | 174 (12.6) |
Different categories of samples | |||||
Pork | 784 | 8 (1.0 |
81 (10.3 |
7 (0.9 |
96 (12.3 |
Beef and mutton | 298 | 3 (1.0 |
35 (11.7 |
2 (0.7 |
40 (13.4 |
Chicken | 264 | 3 (1.14 |
29 (11.0 |
1 (0.4 |
33 (12.5 |
Environment samples | 41 | 0 (0 |
5 (12.2 |
0 (0 |
5 (12.2 |
Total | 1,387 | 14 (1.0) | 150 (10.8) | 10 (0.7) | 174 (12.6) |
Result of drug susceptibility of Listeria spp_ isolates_
Antibiotics | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Resistant isolates | Intermediate isolates | Sensitive isolates | Resistance rates (%) | Resistant isolates | Intermediate isolates | Sensitive isolates | Resistance rates (%) | Resistant isolates | Intermediate isolates | Sensitive isolates | Resistance rates (%) | |
Penicillin | 13 | 0 | 1 | 92.9 | 2 | 0 | 20 | 9.1 | 3 | 0 | 7 | 30.0 |
Ofloxacin | 1 | 2 | 11 | 7.1 | 1 | 13 | 8 | 4.6 | 2 | 0 | 8 | 20.0 |
Cefoxitin | 14 | 0 | 0 | 100 | 0 | 0 | 22 | 0 | 2 | 0 | 8 | 20.0 |
Sulfamethoxazole | 11 | 0 | 3 | 78.6 | 10 | 1 | 11 | 45.5 | 4 | 0 | 6 | 40.0 |
Tetracycline | 14 | 0 | 0 | 100 | 14 | 0 | 8 | 63.6 | 4 | 0 | 6 | 40.0 |
Gentamicin | 3 | 0 | 11 | 21.4 | 0 | 0 | 22 | 0 | 1 | 0 | 9 | 10.0 |
Streptomycin | 2 | 1 | 11 | 14.3 | 5 | 0 | 17 | 23.7 | 1 | 0 | 9 | 10.0 |
Erythromycin | 13 | 1 | 0 | 92.9 | 4 | 4 | 14 | 18.2 | 3 | 1 | 6 | 30.0 |
Acetylspiramycin | 13 | 0 | 1 | 92.9 | 5 | 0 | 17 | 22.7 | 3 | 0 | 7 | 30.0 |
Fosfomycin | 7 | 7 | 0 | 50.0 | 18 | 0 | 4 | 81.8 | 4 | 2 | 4 | 40.0 |