Acceso abierto

Establishment and Application of a Dual TaqMan Real-Time PCR Method for Proteus Mirabilis and Proteus Vulgaris

RUI YANG

RUI YANG

Chongqing Academy of Animal ScienceChongqing, China
Buscar este autor en
Sciendo|Google Scholar
YANG, RUI
, 
GUOYANG XU

GUOYANG XU

Chongqing Academy of Animal ScienceChongqing, China
Buscar este autor en
Sciendo|Google Scholar
XU, GUOYANG
, 
XIAOYOU WANG

XIAOYOU WANG

Chongqing Academy of Animal ScienceChongqing, China
Buscar este autor en
Sciendo|Google Scholar
WANG, XIAOYOU
, 
ZHICHU QING

ZHICHU QING

Chongqing Nanchuan Animal Disease Prevention And Control CenterChongqing, China
Buscar este autor en
Sciendo|Google Scholar
QING, ZHICHU
 y 
LIZHI FU

LIZHI FU

Chongqing Academy of Animal ScienceChongqing, China
Buscar este autor en
Sciendo|Google Scholar
FU, LIZHI
  
25 ago 2020
Establishment and Application of a Dual TaqMan Real-Time PCR Method for Proteus Mirabilis and Proteus Vulgaris's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Descargar portada
Categoría del artículo: original-paper
Publicado en línea: 25 ago 2020
Páginas: 293 - 300
Recibido: 03 may 2020
Aceptado: 08 jul 2020
DOI: https://doi.org/10.33073/pjm-2020-032
Palabras clave
© 2020 Rui Yang et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

P. mirabilis standard curve (Note: log = 1og10).
P. mirabilis standard curve (Note: log = 1og10).

Fig. 2.

P. vulgaris standard curve (Note: log = 1og10).
P. vulgaris standard curve (Note: log = 1og10).

Fig. 3.

Detection limits of P. mirabilis and P. vulgaris in a Dual TaqMan Real-Time PCR Method.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 6.08 × 107 – 6.08 × 102 CFU/ml. When the concentration of P. mirabilis was 6.08 × 10 CFU/ml, no amplification curve was obtained. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 4.46 × 107 – 4.46 × 102 CFU/ml. When the concentration of P. vulgaris was 4.46 × 10 CFU/ml, no amplification curve was obtained.
Detection limits of P. mirabilis and P. vulgaris in a Dual TaqMan Real-Time PCR Method.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 6.08 × 107 – 6.08 × 102 CFU/ml. When the concentration of P. mirabilis was 6.08 × 10 CFU/ml, no amplification curve was obtained. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 4.46 × 107 – 4.46 × 102 CFU/ml. When the concentration of P. vulgaris was 4.46 × 10 CFU/ml, no amplification curve was obtained.

Fig. 4.

Detection limits of P. mirabilis and P. vulgaris in contaminated pork.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.
Detection limits of P. mirabilis and P. vulgaris in contaminated pork.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.

Fig. 5.

Detection limits of P. mirabilis and P. vulgaris in contaminated milk.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.
Detection limits of P. mirabilis and P. vulgaris in contaminated milk.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.

Bacterial strains used in the specificity assessment_

StrainOriginFAMHEX
Proteus mirabilisCVCC4106+−
Proteus mirabilisCVCC1969+−
Proteus mirabilisATCC35659+−
Proteus mirabilisCMCC49001+−
Proteus mirabilisIsolated by lab+−
Proteus mirabilisIsolated by lab+−
Proteus mirabilisIsolated by lab+−
Proteus mirabilisIsolated by lab+−
Proteus vulgarisATCC6896−+
Proteus vulgarisCMCC 49008−+
Proteus vulgarisCMCC49027−+
Proteus vulgarisCMCC 49105−+
Proteus vulgarisIsolated by lab−+
Proteus vulgarisIsolated by lab−+
Proteus vulgarisIsolated by lab−+
Proteus penneriATCC 33519−−
Proteus penneriNTCC 35198−−
Providencia rettgeriATCC 31052−−
Providencia rettgeriCVCC3947−−
Morganella morganiiATCC9237−−
Morganella morganiiCICC71786−−
SalmonellaATCC14028−−
SalmonellaCVCC2227−−
SalmonellaIsolated by lab−−
SalmonellaIsolated by lab−−
Escherichia coliCICC52719−−
Escherichia coliIsolated by lab−−
Escherichia coliIsolated by lab−−
Staphylococcus aureusATCC25923−−
Staphylococcus aureusIsolated by lab−−
Campylobacter jejuniCICC 22936−−
Campylobacter jejuniIsolated by lab−−
Mannheimia haemolyticaATCC29695−−
Pseudomonas aeruginosaIsolated by lab−−
Lactobacillus acidophilusCICC6074−−
Bacillus subtilisCICC20445−−

Primer and TaqMan probe sequences used in this study_

PathogenTarget geneAccession numberPrimer (position)Sequence (5’ → 3’)Amplicon length (bp)
Proteus mirabilisureRCP044134.1  64FACTACCCATCAGATTATGTCAT101
165RCTGTTTGAGGAAAATGCAATTTA
136PFAM-ATTCACACCCTACCCAACATTCAT-BHQ1
Proteus vulgarisblaBD37831.1503FTCGTAAAGAGCCTGAATTAA229
732RATCACCACTACCGGTTTTATC
532PHEX-TCATGGTGATCCTCGTGATACTA-BHQ1
Idioma:
Inglés
Calendario de la edición:
4 veces al año
Temas de la revista:
Ciencias de la vida, Microbiología y virología
RSS Feed de revista