Acceso abierto

Antimicrobial resistance and virulence genes in staphylococci isolated from aviary capercaillies and free-living birds in south-eastern Poland


Cite

Multidrug resistance profiles of isolated Staphylococcus strains

Species of bird Number of Staphylococcus (% strains of all isolated strains) Phenotypic resistance combination pattern (number of classes of antimicrobial agents) Number of strains
no resistance 10
β-lactams (1) 6
macrolides (1) 7
fusidic acid (1) 6
fluoroquinolones (1) 1
fusidic acid, fluoroquinolones (2) 5
phenicols, tetracyclines (2) 1
fluoroquinolones, β-lactams (2) 1
fluoroquinolones, fusidic acid, β-lactams (3) 2
fluoroquinolones, macrolides, β-lactams (3) 2
macrolides, β-lactams, tetracyclines (3) 2
fluoroquinolones, fusidic acid, tetracyclines (3) 1
Capercaillie fluoroquinolones, fusidic acid, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4) 1
(Tetrao urogallus) 57 (44.2) fluoroquinolones, tetracyclines, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, fusidic acid, β-lactams, tetracyclines (4) 1
fluoroquinolones, fusidic acid, β-lactams, macrolides (4) 1
fluoroquinolones, tetracyclines, macrolides, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, macrolides, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, aminoglycosides, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, macrolides, β-lactams, tetracyclines, phenicols (5) 1
fluoroquinolones, macrolides, β-lactams, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (5) 2
fluoroquinolones, macrolides, β-lactams, Fusidic acid, aminoglycosides, sulfonamide + dihydrofolate reductase inhibitor (6) 1
fluoroquinolones, macrolides, β-lactams, Fusidic acid, aminoglycosides, tetracyclines, phenicols, sulfonamide + dihydrofolate reductase inhibitor (8) 2
no resistance 7
β-lactams (1) 1
macrolides (1) 1
tetracyclines (1) 2
sulfonamide + dihydrofolate reductase inhibitor (1) 1
macrolides, tetracyclines (2) 2
Fusidic acid, tetracyclines (2) 3
Fusidic acid, fluoroquinolones (2) 1
macrolides, β-lactams (2) 1
White stork (Ciconia ciconia) 27 (20.9) fusidic acid, fluoroquinolones, tetracyclines (3) fusidic acid, fluoroquinolones, β-lactams (3) 1 1
fusidic acid, fluoroquinolones, β-lactams, macrolides (4) 1
fusidic acid, fluoroquinolones, macrolides, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fusidic acid, fluoroquinolones, macrolides, β-lactams, tetracyclines (5) 1
fusidic acid, fluoroquinolones, macrolides, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (5) 1
fusidic acid, fluoroquinolones, macrolides, β-lactams, tetracyclines, phenicols (6) 1
fusidic acid, fluoroquinolones, aminoglycosides, β-lactams, tetracyclines, phenicols (6) 1
no resistance 1
phenicols (1) 1
β-lactams, tetracyclines (2) 1
fluoroquinolones, macrolides, tetracyclines (3) 4
macrolides, β-lactams, tetracyclines (3) 1
fluoroquinolones, β-lactams, tetracyclines (3) 1
fluoroquinolones, macrolides, fusidic acid, tetracyclines (4) 2
fluoroquinolones, β-lactams, fusidic acid, tetracyclines (4) 4
Common pheasant fluoroquinolones, β-lactams, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (4) 1
(Phasianus colchicus) 22 (17.1) fluoroquinolones, fusidic acid, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, β-lactams, tetracyclines, macrolides (4) 1
fluoroquinolones, fusidic acid, tetracyclines, macrolides, phenicols (5) 1
fluoroquinolones, fusidic acid, β-lactams, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (5) 1
fluoroquinolones, fusidic acid, β-lactams, tetracyclines, macrolides, sulfonamide + dihydrofolate reductase inhibitor (6) 1
fluoroquinolones, fusidic acid, β-lactams, tetracyclines, macrolides, phenicols, sulfonamide + dihydrofolate reductase inhibitor (7) 1
Tawny owl no resistance 4
6 (4.6) β-lactams (1) 1
(Strix aluco) macrolides, fusidic acid, tetracyclines (3) 1
Common kestrel 5 (3.9) no resistance 4
(Falco tinnunculus) fluoroquinolones, fusidic acid, macrolides (3) 1
Common blackbird (Turdus merula) 4 (3.1) no resistance 4
no resistance 1
Mute swan 3 (2.3) fluoroquinolones, β-lactams (2) 1
(Cygnus olor) fluoroquinolones, β-lactams, fusidic acid (3) 1
Song thrush no resistance 1
(Turdus 3 (2.3) fluoroquinolones, fusidic acid (2) 1
philomelos) β-lactams, macrolides (2) 1
Grey heron (Ardea cinerea) 1 (0.8) macrolides, aminoglycosides (2) 1
Great spotted woodpecker (Dendrocopos major) 1 (0.8) no resistance 1

Nucleotide sequences and sizes of PCR products of amplified genes

Gene Oligonucleotide sequence (5′-3′) Amplicon size (bp) PCR conditions Reference
mecA AAAATCGATGGTAAAGGTTGGC AGTTCTGGCACTACCGGATTTGC 533 94℃, 5 min, 40 cycles of 94℃ for 1 min, 58℃ for 1 min, 72℃ for 2 min, final extension 72℃ for 5 min (23)
mecC GAA AAA AAG GCT TAG AAC GCC TC GAA GAT CTT TTC CGT TTT CAG C 138 94℃, 15 min, 30 cycles of 94℃ for 30 s, 59℃ for 1 min, 72℃ for 1 min, final extension for 10 min (35)
blaZ ermA ACTTCAACACCTGCTGCTTTC TAGGTTCAGATTGGCCCTTAG TCT AAAAAG CATGTAAAAGAA TGA TTATAATTATTT GATAGC TTC 173 645 95℃, 3 min, 30 cycles of 95℃ for 30 s, 54℃ for 30 s, 72℃ for 30 s, final extension 72℃ for 4 min (7)
ermB TAACGACGAAACTGGCTAAAA ATCTGTGGTATGGCGGGTAAG 416 95℃, 3 min, 30 cycles of 95℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, final extension 72℃ for 5 min (36)
ermC TAATCGTGGAATACGGGTTTG AATCGTCAATTCCTGCATGT 299
tetK GTAGCGACAATAGGTAATAGT GTAGTGACAATAAACCTCCTA 360
tetM CATATGTCCTGGCGTGTCTA AGTGGAGCGATTACAGAA 158 94℃, 5 min, 30 cycles of 94℃ for 1 min, 57℃ for 1 min, 72℃ for 1 min, (18)
tetL ATAAATTGTTTCGGGTCGGTAAT AACCAGCCAACTAATGACAATGAT 1077 final extension 72℃ for 5 min
tetO AACTTAGGCATTCTGGCTCAC TCCCACTGTTCCATATCGTCA 514
msrA/B GCAAATGGTGTAGGTAAGACAACT ATCATGTGATGTAAACAAAAT 399 95℃, 3 min, 35 cycles of 93℃ for 30 s, 55℃ for 2 min, 74℃ for 1 min, final extension 72℃ 90 s (36)
Aac(6′)/aph(2ʺ) CAGAGCCTTGGGAAGATGAAG CCTCGTGTAATTCATGTTCTGGC 348 94℃, 10 min, 35 cycles of 94℃ for 45 s, 60℃ for 60 s, 72℃ for 60 s, final extension cycle 72℃ for 5 min (39)
norA TTTGTTTTCAGTGTCAGAATTTATGTTTG GGCTTGGTGAAATATCAGCTATTAAAC 140 94℃, 5 min, 30 cycles of 94℃ for 30 s, 60℃ for 30 s, 72℃ for 60 s, final extension 72℃ for 5 min (26)
cfr TGA AGT ATA AAG CAG GTT GGG AGT CA ACC ATA TAA TTG ACC ACA AGC AGC 746 94℃, 2 min, 30 cycles of 94℃ for 30 s, 45℃ for 30 s, and 72℃ for 45 s, final extension 72℃ for 1 min (13)
mphC GAG ACT ACC AAG AAG ACC TGA CG CAT ACG CCG ATT CTC CTG AT 530 95℃, 5 min, 35 cycles of 94℃ for 1 min, 59℃ for 1 min, 72℃ for 2 min, final extension 72℃ for 1 min (16)
sea TGCATGTTTTCAGAGTTAATC ACGATCAATTTTTACAGC 544
seb TCTTTGTCGTAAGATAAACTTC GAATGATATTAATTCGCATC 416 94℃, 5 min, 35 cycles of 94℃ for 2 min, 57℃ for 2 min, 72℃ for 1 min, (22)
sec GACATAAAAGCTAGGAATTT AAATCGGATTAACATTATCCA 257 final extension 72℃ for 7 min
sed TTACTAGTTTGGTAATATCTCCTT CCACCATAACAATTAATGC 334
see ATAGATAAAGTTAAAACAAGCAA TAACTTACCGTGGACCC 170
tst ACCCCTGTTCCCTTATCATC TTTTCAGTATTTGTAACGCC 326
pvl ATCATTAGGTAAAATGTCTGGACATGATCCA GCATCAASTGTATTGGATAGCAAAAGC 433 95℃, 5 min, 30 cycles of 94℃ for 1 min, 55℃ for 30 s, 72℃ for 1 min, (38)
eta GCAGGTGTTGATTTAGCATT AGATGTCCCTATTTTTGCTG 93 final extension at 72℃ for 5 min
etb ACAAGCAAAAGAATACAGCG GTTTTTGGCTGCTTCTCTTG 226

Total number of birds and number and type of organs from which bacteria of the genus Staphylococcus were isolated

Number of Staphylococcus strains isolated from individual organs or tissue
Bird species Total examined animals Heart Liver Spleen Tarsal joint Conjunctiva Palatal fissure Yolk sac Dead embryo
Capercaillie (Tetrao urogallus) 73 5 5 9 4 5 7 9 13
White stork (Ciconia ciconia) 35 3 3 5 3 7 6 - -
Common pheasant(Phasianus colchicus) 46 1 3 6 1 5 4 2 -
Tawny owl (Strix aluco) 10 - 1 2 - 1 2 - -
Common kestrel (Falco tinnunculus) 8 1 - 2 - - 2 - -
Common blackbird (Turdus merula) 7 - - - 1 1 2 - -
Mute swan (Cygnus olor) 5 - 1 - - 1 1 - -
Song thrush (Turdus philomenos) 5 - - 1 - - 2 - -
Grey heron (Ardea cinerea) 2 - 1 - - - - - -
Great spotted woodpecker (Dendrocopos major) 4 - - 1 - - - - -
Common buzzard (Buteo buteo) 3 - - - - - - - -
Black grouse (Lyrurus tetrix) 2 - - - - - - - -
Common swift (Apus apus) 4 - - - - - - - -
Meadow pipit (Anthus pratensis) 5 - - - - - - - -
Fieldfare (Turdus pilaris) 4 - - - - - - - -
Lesser spotted eagle (Clanga pomarina) 1 - - - - - - - -
Total 214 10 14 26 9 20 26 11 13

Percentage of Staphylococcus strains isolated from individual bird species resistant to specific antibacterial agents

Bird species Number of strains Antibiotic
AML25 AMC30 AMP10 P10 FOX30 DA2 C30 E15 CN10 TE30 SXT25 ENR5 FD5
Capercaillie (Tetrao urogallus) 57 12 21% 7 12.3% 21 36.8% 18 31.6% 9 15.8% 23 40.4% 4 7% 19 33.3% 4 7% 14 24.6% 11 19.3% 26 45.6% 20 35.1%
White stork (Ciconia ciconia) 27 5 18.5% 3 11.1% 6 22.2% 5 18.5% 5 18.5% 3 11.1% 2 7.4% 9 33.3% 1 3.7% 12 44.4% 3 11.1% 9 33.3% 12 44.4%
Common pheasant (Phasianus colchicus) 22 10 45.5% 8 36.4% 12 54.5% 11 50.0% 7 31.8% 3 13.6% 3 13.6% 11 50.5% - 20 90/9% 5 22.7% 18 81.8% 11 50.5%
Tawny owl (Strix aluco) 6 - - 1 16.7% - - - - 1 16.7% - 1 16.7% - - 1 16.7%
Common kestrel (Falco tinnunculus) 5 - - - - - - - 20.01 % - - - 20.01 % 20.01 %
Common blackbird (Turdus merula) 4 - - - - - - - - - - - - -
Mute swan (Cygnus olor) 3 1 33.3% 1 33.3% 2 66.6% 2 66.6% 2 66.6% - - - - - - 2 66.6% 1 33.3%
Song thrush (Turdus philomenos) 3 - 1 33.3% 1 33.3% 1 33.3% - - - 1 33.3% - - - 1 33.3% 1 33.3%
Grey heron (Ardea cinerea) 1 - - - - - - - 1 100% 1 100% - - - -
Great spotted woodpecker (Dendrocopus major) 1 - - - - - - - - - - - - -

Presence of genes encoding resistance to antimicrobial agents and staphylococcal toxins in isolated strains

Staphylococcus species
Gene S. sci (n=56) S. xyl (n=14) S. equ (n=12) S. sap (n=8) S. aur (n=6) S. epi (n=6) S. coh (n=6) S. pse (n=3) S. hae (n=3) S. len (n=3) S. klo (n=2) S. suc (n=2) S. vit (n=2) S. con (n=1) S. nep (n=1) S. arl (n=1) S. pas (n=1) S. chr (n=1) S. war (n=1) Total %
mecA 7 1 1 9 7.0
mecC
blaZ 2 3 2 4 2 1 1 1 16 12.4
msrA/B 3 2 3 3 1 1 2 1 1 17 13.2
ermA 5 1 6 4.7
ermB 12 1 2 1 2 2 1 21 16.3
ermC 7 3 5 1 5 3 1 1 1 27 20.9
tetK 19 5 4 5 2 4 4 2 2 1 1 49 38.0
tetM 16 7 5 3 3 1 1 1 1 1 1 40 31.0
tetL 5 1 1 7 5.4
tetO 3 1 1 1 1 7 5.4
cfr 1 1 1 1 1 5 3.9
norA 6 2 1 1 6 2 1 1 20 15.5
aac(6′)/ aph(2ʺ) 3 1 1 1 1 7 5.4
mphC 7 5 3 2 2 2 1 1 23 17.8
sea 1 1 1 3 2.3
seb
sec
sed
see
pvl
eta
etb
tst 1 1 0.8
129

Phenotypic antimicrobial resistance of Staphylococcus strains

Antibiotic
Species AML25 AMC30 AMP10 P10 FOX30 DA2 C30 E15 CN10 TE30 SXT25 ENR5 FD5
S. sciuri, n = 56 R 15 8 18 16 14 2 2 - 1 15 3 26 28
I - - - - - 12 - 5 1 1 - - -
S. xylosus, n = 14 R 3 2 3 3 1 - 2 4 - 6 2 6 6
I - - - - - 1 1 2 - - - - -
S. equorum, n = 12 R 1 - 1 1 1 1 2 2 - 3 1 1 2
I - - - - - - - 3 1 - - - -
S. saprophyticus, n = 8 R - 1 2 1 - - - 5 - 7 2 5 1
I - - - - - - - - - - - - -
S. aureus, n = 6 R 1 4 4 4 - - - - - - - 3 1
I - - - - - 3 - 4 - - - - -
S. epidermidis, n = 6 R 1 1 4 3 - 3 - 4 - 4 5 5 -
I - - - - - - - - - - - - -
S. cohnii, n = 6 R 3 1 3 2 3 2 - 3 - 3 2 3 2
I - - - - - 1 - 2 1 - - - -
S. pseudintermedius, n = 3 R 1 1 1 1 - 1 1 1 - 1 - 1 -
I - - - - - - - 1 - - - - -
S. haemolyticus, n = 3 R 1 - 2 2 1 1 - 1 1 1 2 1 1
I - - - - - - - - - - - - -
S. lentus, n = 3 R - - - - - - - - - 1 - 1 1
I - - - - - - - - - - - - -
S. kloosii, n = 2 R - - 1 - - - - - - 1 - - 1
I - - - - - - - 1 - - - - -
S. succinus, n = 2 R - - - - - - - 1 - - - - -
I - - - - - - - - - - - - -
S. vitulinus, n = 2 R - 1 1 1 1 - - 1 - - - 1 1
I - - - - - - - - - - - - -
S. condimenti, n =1 R 1 - 1 1 1 1 1 - - - - 1 1
I - - - - - - - 1 1 1 1 - -
S. nepalensis, n = 1 R - - - - - - - - - 1 - 1 -
I - - - - - - 1 - - - - - -
S. arlettae, n = 1 R - - - 1 - - - 1 - 1- 1 1
I - - - - - - - - - - - - -
S. pasteuri, n = 1 R - - 1 - - - - - - - - - -
I - - - - - - - - - - - - -
S. chromogenes, n = 1 R 1 1 1 1 1 1 - 1 - 1 1 1 1
I - - - - - - - - - - - - -
S. warneri, n = 1 R - - - - - - - - - - - - -
I - - - - - - - - - - - - -
Total number 28 20 43 37 23 29 9 43 6 47 19 57 47
% 21.7 15.5 33.3 28.7 17.8 22.5 7.0 33.3 4.7 36.4 14.7 44.2 36.4
eISSN:
2450-8608
Idioma:
Inglés
Calendario de la edición:
4 veces al año
Temas de la revista:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine