Acceso abierto

Cytotoxic and apoptotic effect of nanoclinoptilolite on canine osteosarcoma cell lines

, ,  y   
08 oct 2020

Cite
Descargar portada

Fig. 1

Effect of nanoclinoptilolite on cell viability of canine OSA D-17
Effect of nanoclinoptilolite on cell viability of canine OSA D-17

Fig. 2

Caspase-3 and -7 activity after treatment with different concentrations of nanoclinoptilolite in canine D-17 OSA cells. Treatment over 24 h: A – control; B – 10 μg/mL; C– 20 μg/mL; D – 30 μg/mL. Treatment over 48 h: E – control; F – 10 μg/mL; G – 20 μg/mL; H– 30 μg/mL
Caspase-3 and -7 activity after treatment with different concentrations of nanoclinoptilolite in canine D-17 OSA cells. Treatment over 24 h: A – control; B – 10 μg/mL; C– 20 μg/mL; D – 30 μg/mL. Treatment over 48 h: E – control; F – 10 μg/mL; G – 20 μg/mL; H– 30 μg/mL

Fig. 3

Effect of nanoclinoptilolite on the BAX/BCL-2 ratio in canine D-17 OSA cells
Effect of nanoclinoptilolite on the BAX/BCL-2 ratio in canine D-17 OSA cells

Primer sequences used for qRT-PCR

NCBI reference sequenceGeneForward primer (5´→3´)Reverse primer (5´→3´)
NM_001003142.2GAPDHAGTCAAGGCTGAGAACGGGAAATCCACAACATACTCAGCACCAGC
NM_001002949.1BCL2CATGCCAAGAGGGAAACACCAGAAGTGCTTTGCATTCTTGGATGAGGG
NM_001003011.1BAXTTCCGAGTGGCAGCTGAGATGTTTTGCTGGCAAAGTAGAAGAGGGCAA

Effect of nanoclinoptilolite on cell viability of canine D-17 OSA_ The results represent the mean ± standard deviation

Nanoclinoptilolite concentration (μg/mL)24 h48 h72 h
% Viability X¯±Sx$\overline{X}\pm {{S}_{_{x}^{-}}}$XP% Viability X¯±Sx$\overline{X}\pm {{S}_{_{x}^{-}}}$XP% Viability X¯±Sx$\overline{X}\pm {{S}_{_{x}^{-}}}$XP
Control100 ± 5.66

Statistical difference between groups with different letters in the same column is significant

100 ± 6.09

Statistical difference between groups with different letters in the same column is significant

100 ± 3.15

Statistical difference between groups with different letters in the same column is significant

1092.62 ± 8.29

Statistical difference between groups with different letters in the same column is significant

>0.0560.24 ± 5.50

Statistical difference between groups with different letters in the same column is significant

***56.08 ± 3.57

Statistical difference between groups with different letters in the same column is significant

***
2081.45 ± 5.11

Statistical difference between groups with different letters in the same column is significant

***48.50 ± 1.83

Statistical difference between groups with different letters in the same column is significant

***31.95 ± 2.24

Statistical difference between groups with different letters in the same column is significant

***
3069.35 ± 2.24

Statistical difference between groups with different letters in the same column is significant

***37.27 ± 2.25

Statistical difference between groups with different letters in the same column is significant

***23.23 ± 6.89

Statistical difference between groups with different letters in the same column is significant

***
4061.66 ± 3.01

Statistical difference between groups with different letters in the same column is significant

***30.12 ± 2.23

Statistical difference between groups with different letters in the same column is significant

***19.87 ± 5.45

Statistical difference between groups with different letters in the same column is significant

***
5056.88 ± 2.45

Statistical difference between groups with different letters in the same column is significant

***26.16 ± 4.14

Statistical difference between groups with different letters in the same column is significant

***15.14 ± 7.29

Statistical difference between groups with different letters in the same column is significant

***
7551.92 ± 2.02

Statistical difference between groups with different letters in the same column is significant

***21.19 ± 0.42

Statistical difference between groups with different letters in the same column is significant

***12.02 ± 1.70

Statistical difference between groups with different letters in the same column is significant

***
10048.08 ± 1.87

Statistical difference between groups with different letters in the same column is significant

***19.14 ± 1.55

Statistical difference between groups with different letters in the same column is significant

***10.31 ± 0.26

Statistical difference between groups with different letters in the same column is significant

***
15044.60 ± 1.80

Statistical difference between groups with different letters in the same column is significant

***18.19 ± 0.53

Statistical difference between groups with different letters in the same column is significant

***9.41 ± 0.15

Statistical difference between groups with different letters in the same column is significant

***
20043.80 ± 3.91

Statistical difference between groups with different letters in the same column is significant

***18.00 ± 0.74

Statistical difference between groups with different letters in the same column is significant

***9.92 ± 0.28

Statistical difference between groups with different letters in the same column is significant

***

Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 24 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells

% live% apoptotic% dead
Control92.3 ± 2.36

Statistical difference between groups with different letters in the same column is significant

7.62 ± 1.83

Statistical difference between groups with different letters in the same column is significant

0.12 ± 0.017

Statistical difference between groups with different letters in the same column is significant

10 μg/mL93.65 ± 1.61

Statistical difference between groups with different letters in the same column is significant

5.78 ± 0.87

Statistical difference between groups with different letters in the same column is significant

0.57 ± 0.18

Statistical difference between groups with different letters in the same column is significant

20 μg/mL91.57 ± 0.43

Statistical difference between groups with different letters in the same column is significant

7.60 ± 0.32

Statistical difference between groups with different letters in the same column is significant

0.95 ± 0.004

Statistical difference between groups with different letters in the same column is significant

30 μg/mL86.65 ± 0.41

Statistical difference between groups with different letters in the same column is significant

12.77 ± 0.51

Statistical difference between groups with different letters in the same column is significant

0.52 ± 0.07

Statistical difference between groups with different letters in the same column is significant

P0.0200.0310.05

Effect of nanoclinoptilolite on the Bax/Bcl-2 ratio in canine D-17 OSA cells for 24 and 48 h (* P<0_05)

Nanoclinoptilolite concentration24 h48 h
10 μg/mL0.443.00
20 μg/mL0.448.88
30 μg/mL0.7514.24

Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 48 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells

% live% apoptotic% dead
Control92.63 ± 0.63

Statistical difference between groups with different letters in the same column is significant

7.25 ± 0.73

Statistical difference between groups with different letters in the same column is significant

0.22 ± 0.04

Statistical difference between groups with different letters in the same column is significant

10 g/mL91.3 ± 0.41

Statistical difference between groups with different letters in the same column is significant

8.53 ± 0.93

Statistical difference between groups with different letters in the same column is significant

0.17 ± 0.02

Statistical difference between groups with different letters in the same column is significant

20 μg/mL85.35 ± 0.30

Statistical difference between groups with different letters in the same column is significant

14.2 ± 0.5

Statistical difference between groups with different letters in the same column is significant

0.45 ± 0.09

Statistical difference between groups with different letters in the same column is significant

30 μg/mL23.8 ± 1.96

Statistical difference between groups with different letters in the same column is significant

23.8 ± 1.93

Statistical difference between groups with different letters in the same column is significant

1.2 ± 0.03

Statistical difference between groups with different letters in the same column is significant

P0.0200.0310.05