Evaluation of direct metagenomics and target enriched approaches for high-throughput sequencing of field rabies viruses
, , y
16 nov 2019
Acerca de este artículo
Publicado en línea: 16 nov 2019
Páginas: 471 - 479
Recibido: 06 mar 2019
Aceptado: 04 nov 2019
DOI: https://doi.org/10.2478/jvetres-2019-0067
Palabras clave
© 2019 A. Orłowska et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1

Fig. 2

Primers employed for RT-PCR of field RABV samples
Amplicon | Primer name | Primer sequence 5′-3′ | Location genome in RABV | Amplicon size |
---|---|---|---|---|
A | RVA_forward | ATGGATGCCGACAAGATTGTATT | 1–23 | 4499 |
RVA_reverse | CAGGGGGTGCATCAGGGGAAT | 4478–4499 | ||
B | RVB_forward | ATCCCAGAGATGCAATCATCC | 4418–4439 | 3860 |
RVB_reverse | TGAGTAGAATGGTAGGACTGGCACC | 8251–8276 | ||
C | RVC_forward | GAACCCAGATCTTGGAGAGAGAA | 8172–8195 | 3631 |
RVC_reverse | TTCGGATTCAAGATCTTGTTTT | 11779–11801 | ||
A1 | RVA_forward | as above | 2267 | |
RVA1_reverse | TGGAATTTCTTGGAATTGGCCAAAGC | 2241–2267 | ||
A2 | RVA2_forward | GCTCATGACGGATCCAAACTCCC | 2193–2216 | 2300 |
RVA_reverse | as above | |||
B1 | RVB_forward | as above | 2330 | |
RVB1_reverse | GATTCAGGAATCTCAAAGATTTGCGT | 6724–6750 | ||
B2 | RVB2_forward | TTGACTCCTTATATCAAAACCCAGA | 6640–6665 | 1636 |
RVB_reverse | as above | |||
C1 | RVC_forward | as above | 2016 | |
RVC1_reverse | GTCATGGTTCTAGCTGCATGGCG | 10155–10188 | ||
C2 | RVC2_forward | ATGAGGCAGGTGCTGGGTG | 10054–10073 | 1750 |
RVC_reverse | as above |
Details of samples in the comparative study of extraction methods_ RNA concentration, virus detection using real-time RT-PCR, and the number of reads obtained during whole-genome sequencing
Group | Isolate | Sample origin | Collection date | Extraction method /RT-PCR procedure | Concentration of dsDNA after clean-up (Qubit HS) (ng/µL) | Verification of HTS library | Total number of reads | Number of viral reads | % of viral reads | Number of RABV reads (centrifuge) | Number of contigs | Average coverage | ||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Direct metagenomic approach | I | 767121097L | red fox | 1997 | A – QIAmp Viral RNA Mini | 1.45 | + | 22,250 | 117 | 0.0525 | 3 | - | - | |
965180404L | red fox | 2004 | Kit/ RT + amplification of dsDNA with Klenow | 1.06 | + | 15,282 | 67 | 0.438 | 0 | - | - | |||
1045120899L | red fox | 1999 | fragment | 1.08 | + | 158,723 | 496 | 0.31 | 8 | - | - | |||
II | 767121097L | red fox | 1997 | 5.06 | − | - | - | - | - | - | ||||
965180404L | red fox | 2004 | B – Direct-zol RNA MiniPrep | 1.21 | + | 160,354 | 1,1170 | 6.965 | 132 | 19 | 3.5 | |||
1045120899L | red fox | 1999 | Zymo amplification Research/ of RT dsDNA + with | 1.15 | + | 200,756 | 4,218 | 2.101 | 133 | 6 | 2.5 | |||
1321180108L | red fox | 2008 | Klenow fragment | 1.2 | + | 517,696 | 70,436 | 13.605 | 1,359 | 1 | 32 | |||
1379120910L | red fox | 2010 | 2.21 | + | 948,295 | 68,491 | 7.222 | 4,765 | 3 | 152 | ||||
III | 1996181013L* | red fox | 2013 | 1.18 | + | 839,440 | 47,118 | 5.613 | 28,116 | 1 | 495 | |||
1992121113L | red fox | 2013 | 13.4 | + | 423,115 | 1,417 | 0.334 | 62 | 9 | 2 | ||||
1739120912L | red fox | 2012 | 2.93 | + | 4,216,387 | 14,103 | 0.334 | 657 | 1 | 15 | ||||
1679180512L* | red fox | 2012 | C – TRIzol/ chloroform/ethanol/ | 2.04 | + | 4,543,264 | 21,683 | 0.4772 | 2,935 | 1 | 71 | |||
1577121111L | red fox | 2011 | RT+ amplification of dsDNA | 4.28 | + | 1,058,492 | 5,313 | 0.05019 | 564 | 1 | 13 | |||
1525180711L | red fox | 2011 | with Klenow fragment | 4.38 | + | 849,062 | 2,023 | 0.238 | 23 | 3 | 1.5 | |||
1391180910L | red fox | 2010 | 3.86 | + | 2,401,009 | 8,487 | 0.3534 | 10 | 3 | 1 | ||||
EBLV-1 | 2018 | + | 460,751 | 178,828 | 38.812 | 32,232 | 1 | 571 | ||||||
RABV-enriched approach | IV | 1045120899L | as above | as above | 16.8 | + | 2,697,616 | 2,560,850 | 94.930 | 1,342,569 | 1 | 38,039 | ||
965180404L | 56.5 | + | 2,951,939 | 2,765,165 | 93.67 | 1,503,424 | 1 | 41,961 | ||||||
767121097L | 76.6 | + | 3,106,953 | 2,871,569 | 92.42 | 1,686,411 | 1 | 41,697 | ||||||
1379120910L | 55.2 | + | 754,635 | 711,112 | 94.23 | 372,141 | 1 | 11,346 | ||||||
1321180108L | 25.1 | + | 1,115,667 | 951,915 | 85.322 | 557,949 | 3 | 5,962 | ||||||
1525180711L | 75.5 | + | 869,224 | 824,305 | 94.832 | 463,772 | 1 | 12,144 | ||||||
1739120912L | 48.5 | + | 682,577 | 645,311 | 94.54 | 362,514 | 1 | 9,500 | ||||||
1996181013L* | 65.4 | + | 760,390 | 718,626 | 94.507 | 423,322 | 1 | 10,144 | ||||||
1577121111L | 81.4 | + | 904,532 | 846,126 | 93.54 | 507,207 | 1 | 12,122 | ||||||
1992121113L | 75.9 | + | 978,751 | 922,826 | 94.286 | 525,370 | 1 | 13,536 | ||||||
1391180910L | 47.3 | + | 985,144 | 943,962 | 95.819 | 539,481 | 1 | 13,075 | ||||||
2191180915L | red fox | 2015 | C – TRIzol/chloroform/ | 93 | + | 967,059 | 908,214 | 93.915 | 528,055 | 1 | 13,089 | |||
1990121113L | red fox | 2013 | ethanol + virus enrichment | 70.2 | + | 893,272 | 834,573 | 93.428 | 464,788 | 1 | 12,217 | |||
2176120515L | red fox | 2015 | 87.6 | + | 1,294,593 | 1,196,143 | 92.395 | 737,332 | 1 | 17,535 | ||||
2068180814L | red fox | 2014 | 69.6 | + | 1,192,314 | 1,112,910 | 93.340 | 65,4514 | 1 | 16,190 | ||||
2214181115L | red fox | 2015 | 87.6 | + | 1,230,082 | 1,140,045 | 92.680 | 709,820 | 1 | 16,316 | ||||
2067120814L | red fox | 2014 | 62 | + | 1,265,627 | 1,150,880 | 90.933 | 703,662 | 1 | 17,091 | ||||
2066120814L | red fox | 2014 | 68.4 | + | 1,934,161 | 1,741,947 | 90.062 | 1,062,064 | 1 | 25,144 | ||||
2226120916L | red fox | 2016 | 84 | + | 1,133,386 | 1,011,316 | 89.229 | 633,117 | 1 | 14,546 | ||||
2235181116L | red fox | 2016 | 103 | + | 1,947,768 | 1,828,286 | 93.865 | 1,119,736 | 1 | 26,791 | ||||
2236181216P | dog | 2016 | 81.2 | + | 612,073 | 564,607 | 92.245 | 346,010 | 1 | 7,980 | ||||
2237120117L | red fox | 2017 | 96.4 | + | 1,336,571 | 1,225,265 | 91.672 | 758,770 | 1 | 16,869 | ||||
2238181117K | cat | 2017 | 62 | + | 1,034,833 | 918,601 | 88.768 | 562,828 | 1 | 12,576 |