Acceso abierto

Complete Mitochondrial Genome of Contracaecum sp. (Nematoda: Ascarididae) from night herons in China

Yuan-Ping Deng
Yuan-Ping Deng
, 
Rong Li
Rong Li
, 
Hui-Mei Wang
Hui-Mei Wang
, 
Guo-Hua Liu
Guo-Hua Liu
 y 
Ya Tu
Ya Tu
   | 26 oct 2022
Journal of Nematology's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Article Category: Research Note
Publicado en línea: 26 oct 2022
Páginas: -
Recibido: 03 may 2022
DOI: https://doi.org/10.2478/jofnem-2022-0048
Palabras clave
© 2022 Deng et al. published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1

Organization of the complete mitochondrial genome sequence of Contracaecum sp. NCR, noncoding region.
Organization of the complete mitochondrial genome sequence of Contracaecum sp. NCR, noncoding region.

Figure 2

Sliding window analysis of the alignment of complete mtDNAs of available Contracaecum spp. The black line shows the value of nucleotide diversity Pi (π) in a sliding window analysis of window size 300 bp with step size 25 bp, and the value is inserted at its mid-point. Gene boundaries are indicated with a variation ratio per gene.
Sliding window analysis of the alignment of complete mtDNAs of available Contracaecum spp. The black line shows the value of nucleotide diversity Pi (π) in a sliding window analysis of window size 300 bp with step size 25 bp, and the value is inserted at its mid-point. Gene boundaries are indicated with a variation ratio per gene.

Figure 3

Phylogenetic relationships of Contracaecum spp. with species from Ascaridoidea and Heterakoidea. Analysis trees based on amino acid sequences of 12 protein genes by complete mitochondrial genome using BI and ML with Enterobius vermicularis and Wellcomia siamensis as outgroups. BI, Bayesian inference; ML, maximum likelihood.
Phylogenetic relationships of Contracaecum spp. with species from Ascaridoidea and Heterakoidea. Analysis trees based on amino acid sequences of 12 protein genes by complete mitochondrial genome using BI and ML with Enterobius vermicularis and Wellcomia siamensis as outgroups. BI, Bayesian inference; ML, maximum likelihood.

Figure S1

Polymerase chain reaction amplicons from the mitochondrial genome of Contracaecum sp. M: DL5,000 DNA marker; 1: Validation_01; 2: Validation_02; 3: Validation_03; 4:Validation_04.
Polymerase chain reaction amplicons from the mitochondrial genome of Contracaecum sp. M: DL5,000 DNA marker; 1: Validation_01; 2: Validation_02; 3: Validation_03; 4:Validation_04.

Nucleotide composition and skews of Contracaecum sp. mitochondrial genome.

Nucleotide frequency (%)
Gene A G T C A + T (%) AT-skew GC-skew
atp6 22.0 22.0 49.1 6.9 71.1 -0.380 0.526
cox1 19.5 21.8 47.2 11.5 66.7 -0.416 0.307
cox2 21.2 22.1 46.5 10.1 67.7 -0.373 0.372
cox3 18.9 20.9 49.8 10.4 68.7 -0.449 0.333
cytb 19.7 22.0 47.6 10.7 67.3 -0.415 0.343
nad1 19.5 20.5 50.5 9.5 70.0 -0.444 0.364
nad2 20.7 18.2 54.6 6.5 75.3 -0.451 0.474
nad3 20.0 21.4 54.4 4.2 74.4 -0.464 0.674
nad4 21.4 17.0 50.9 10.7 72.3 -0.408 0.226
nad4L 22.9 17.3 55.0 4.8 77.9 -0.411 0.569
nad5 21.2 18.8 51.9 8.1 73.1 -0.420 0.398
nad6 20.7 13.3 58.2 7.8 78.9 -0.475 0.261
rrnS 30.2 19.7 40.4 9.7 70.6 -0.143 0.340
rrnL 27.3 17.5 48.3 6.9 75.6 -0.277 0.436
22 tRNA 31.5 18.7 40.8 9.0 72.3 -0.129 0.352
NCR 37.4 10.3 46.7 5.6 84.1 -0.111 0.290
Total 23.5 19.0 48.7 8.9 72.2 -0.350 0.364

Amino acid frequency of Contracaecum sp. mitochondrial PCGs.

Amino acid Codon Number RSCU (%) Amino acid Codon Number RSCU (%)
Phe TTT 480 1.92 Tyr TAT 154 1.84
Phe TTC 19 0.08 Tyr TAC 13 0.16
Leu TTA 199 2.3 Stop TAA 5 1.43
Leu TTG 216 2.5 Stop TAG 2 0.57
Leu CTT 76 0.88 His CAT 54 1.86
Leu CTC 2 0.02 His CAC 4 0.14
Leu CTA 10 0.12 Gln CAA 20 0.98
Leu CTG 16 0.18 Gln CAG 21 1.02
Ile ATT 214 1.92 Asn AAT 100 1.79
Ile ATC 9 0.08 Asn AAC 12 0.21
Met ATA 76 0.86 Lys AAA 35 0.71
Met ATG 101 1.14 Lys AAG 63 1.29
Val GTT 219 2.61 Asp GAT 62 1.65
Val GTC 13 0.16 Asp GAC 13 0.35
Val GTA 49 0.59 Glu GAA 32 0.84
Val GTG 54 0.64 Glu GAG 44 1.16
Ser TCT 139 3.08 Cys TGT 53 1.96
Ser TCC 6 0.13 Cys TGC 1 0.04
Ser TCA 14 0.31 Trp TGA 21 0.57
Ser TCG 5 0.11 Trp TGG 53 1.43
Pro CCT 66 3.11 Arg CGT 33 3.88
Pro CCC 7 0.33 Arg CGC 1 0.12
Pro CCA 9 0.42 Arg CGA 0 0
Pro CCG 3 0.14 Arg CGG 0 0
Thr ACT 89 3.24 Ser AGT 121 2.68
Thr ACC 6 0.22 Ser AGC 2 0.04
Thr ACA 9 0.33 Ser AGA 36 0.8
Thr ACG 6 0.22 Ser AGG 38 0.84
Ala GCT 72 2.5 Gly GGT 112 2.22
Ala GCC 24 0.83 Gly GGC 21 0.42
Ala GCA 11 0.38 Gly GGA 23 0.46
Ala GCG 8 0.28 Gly GGG 46 0.91

Primers used for assembly validation.

Name Sequence (5'-3') Size (bp)
yeluF1 AGTTGTTGAAGAAGGAGCAGTT
yeluR1 CTAAACATTGACCTAACCACCT 3,564 bp
yeluF2 AGGTGGTTAGGTCAATGTTTAG
yeluR2 ACAGAGTAAACATCAGGGAAAT 3,900 bp
yeluF3 TTGGATTTCCCTGATGTTTACT
yeluR3 CAAACTAAACATACTGCCAACA 2,816 bp
yeluF4 TTGGTCAACAAGATGGTCGTAA
yeluR4 AACTGCTCCTTCTTCAACAACT 3,757 bp

Organization of the complete mt genome of Contracaecum sp. from Beijing, China.

Gene/region Strand Positions Size (bp) Number of aaa Ini/Ter codons Anticodons In
tRNA-Asn (N) H 1–60 60 GTT 0
tRNA-Tyr (Y) H 61–116 56 GTA 0
nad1 H 117–989 873 290 TTG/TAG 0
atp6 H 993–1,591 599 199 ATT/TA +3
tRNA-Lys (K) H 1,592–1,653 62 TTT 0
tRNA-Leu2 (L2) H 1,654–1,708 55 TAA 0
tRNA-Ser1 (S1) H 1,709–1,759 51 TCT 0
nad2 H 1,760–2,605 846 281 TTG/TAA 0
tRNA-Ile (I) H 2,619–2,678 60 GAT +13
tRNA-Arg (R) H 2,679–2,732 54 GCG 0
tRNA-Gln (Q) H 2,733–2,787 55 TTG 0
tRNA-Phe (F) H 2,788–2,846 59 GAA 0
Cytb H 2,847–3,953 1,107 368 TTG/TAA 0
tRNA-Leu1 (L1) H 3,961–4,017 57 TAG +7
cox3 H 4,018–4,782 766 255 TTG/T 0
tRNA-Thr (T) H 4,783–4,843 60 TGT 0
nad4 H 4,844–6,073 1,230 409 TTG/TAA 0
Intergenic region H 6,074–6,195 122 0
cox1 H 6,196–7,771 1,576 525 TTG/T 0
tRNA-Cys (C) H 7,772–7,829 58 GCA 0
tRNA-Met (M) H 7,831–7,890 60 CAT +1
tRNA-Asp (D) H 7,907–7,963 57 GTC +16
tRNA-Gly (G) H 7,965–8,021 57 TCC +1
cox2 H 8,022–8,713 692 230 TTG/TA 0
tRNA-His (H) H 8,714–8,778 65 GTG 0
rrnL H 8,779–9,737 959 0
nad3 H 9,738–10,073 336 111 TTG/TAG 0
nad5 H 10,077–11,659 1,583 527 ATT/TA +3
tRNA-Ala (A) H 11,660–11,716 57 TGC 0
tRNA-Pro (P) H 11,724–11,780 57 TGG +7
tRNA-Val (V) H 11,781–11,837 57 TAC 0
nad6 H 11,838–12,272 435 144 TTG/TAA 0
nad4L H 12,275–12,505 231 76 ATT/TAA +2
tRNA-Trp (W) H 12,506–12,563 58 TCA 0
tRNA-Glu (E) H 12,565–12,624 60 TTC +1
rrnS H 12,625–13,335 711 0
tRNA-Ser2 (S2) H 13,336–13,391 56 TGA 0
Noncoding region H 13,392–14,082 691 0

Mitochondrial genome sequences of nematodes of superfamily Ascaridoidea and Heterakoidea were sequenced completely before the present study and used for phylogenetic analysis.

Superfamily Family Species Size (bp) GenBank accession No.
Ascaridoidea Anisakidae Anisakis pegreffii 14,002 NC_034329
Anisakis simplex 13,899 MK820679
Contracaecum ogmorhini Canada 14,010 KU558727
Contracaecum ogmorhini Australia 14,019 KU558725
Contracaecum ogmorhini South Africa 14,012 KU558726
Contracaecum osculatum 13,823 NC_024037
Contracaecum rudolphii 14,022 NC_014870
Pseudoterranova decipiens 13,962 NC_031645
Pseudoterranova decipiens s.l. 13,965 KU558722
Pseudoterranova krabbei 13,948 NC_031646
Pseudoterranova bulbosa 13,957 KU558720
Pseudoterranova cattani 13,950 KU558721
Ascarididae Ascaris lumbricoides 14,281 NC_016198
Ascaris lumbricoides China 14,303 HQ704900
Ascaris ovis 14,288 NC_036666
Ascaris suum 14,284 NC_001327
Ascaris suum China 14,311 HQ704901
Ascaris sp. Chimpanzee 14,268 KC839986
Ascaris sp. gibbon 14,274 KC839987
Baylisascaris ailuri 14,657 HQ671080
Baylisascaris procyonis 14,781 NC_016200
Baylisascaris schroederi 14,778 NC_015927
Baylisascaris transfuga 14,898 NC_015924
Ophidascaris baylisi 14,784 MW880927
Ophidascaris sp. 14,660 MK106624
Parascaris equorum 13,899 NC_036427
Parascaris univalens 13,920 NC_024884
Toxascaris leonina 14,310 NC_023504
Heterocheilidae Ortleppascaris sinensis 13,828 NC_036669
Toxocaridae Toxocara canis 14,322 NC_010690
Toxocara canis Australia 14,163 EU730761
Toxocara cati 14,029 NC_010773
Toxocara malaysiensis 14,266 NC_010527
Cucullanidae Cucullanus robustus 13,972 NC_016128
Heterakoidea Ascaridiidae Ascaridia columbae 13,931 NC_021643
Ascaridia galli 13,977 NC_021642
Ascaridia sp. 13,862 JX624730
Heterakidae Heterakis beramporia 14,012 NC_029838
Heterakis dispar 13,995 NC_042411
Heterakis gallinarum 13,973 NC_029839
Oxyuroidea Oxyuridae Enterobius vermicularis 14,010 EU281143
Wellcomia siamensis 14,128 NC_016129
eISSN:
2640-396X
Idioma:
Inglés
Calendario de la edición:
Volume Open
Temas de la revista:
Life Sciences, other
RSS Feed de revista