Acceso abierto

Comparison of ascorbic acid metabolism during the development of two jujube varieties

, , , , ,  y   
20 ago 2025

Cite
Descargar portada

Figure 1.

The pathway of AsA metabolism in plants. Note: ①galacturonic acid pathway; ② L-galactose pathway; ③ L-glucose pathway; ④ myo-inositol pathway; ⑤ AsA regeneration and degradation pathway. AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-latone dehydrogenase; GGP, GDP-L-galactose pyrophosphatase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; GSH, glutathione; GSSG, oxidised glutathione; MDHAR, monodehydroascorbate reductase; MIOX, myo-inositol oxygenase; T-AsA, total ascorbic acid.Huang et al.
The pathway of AsA metabolism in plants. Note: ①galacturonic acid pathway; ② L-galactose pathway; ③ L-glucose pathway; ④ myo-inositol pathway; ⑤ AsA regeneration and degradation pathway. AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-latone dehydrogenase; GGP, GDP-L-galactose pyrophosphatase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; GSH, glutathione; GSSG, oxidised glutathione; MDHAR, monodehydroascorbate reductase; MIOX, myo-inositol oxygenase; T-AsA, total ascorbic acid.Huang et al.

Figure 2.

Fruit developmental stages of two jujube varieties. DAF, days after flowering.
Fruit developmental stages of two jujube varieties. DAF, days after flowering.

Figure 3.

Changes in AsA, DHA, T-AsA contents and AsA/DHA ratio during the development of different tissues in two jujube varieties. (A) Changes in AsA, DHA, T-AsA contents and AsA/DHA ratio during fruit development of two jujube varieties. (B) Changes in AsA, DHA, T-AsA contents and AsA/DHA ratio during leaf development of two jujube varieties. (C) Comparison of AsA, DHA, T-AsA contents and AsA/DHA ratio in the petals of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (0.01 < p* < 0.05), ** indicates a highly significant difference (**p < 0.01); a, b, c, etc. represent one-way analysis of variance between different developmental stages of two varieties, with significant differences (Duncan’s multiple range test) assessed at the 5% confidence level. AsA, ascorbic acid; DHA, dehydroascorbic acid; T-AsA, total ascorbic acid; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.
Changes in AsA, DHA, T-AsA contents and AsA/DHA ratio during the development of different tissues in two jujube varieties. (A) Changes in AsA, DHA, T-AsA contents and AsA/DHA ratio during fruit development of two jujube varieties. (B) Changes in AsA, DHA, T-AsA contents and AsA/DHA ratio during leaf development of two jujube varieties. (C) Comparison of AsA, DHA, T-AsA contents and AsA/DHA ratio in the petals of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (0.01 < p* < 0.05), ** indicates a highly significant difference (**p < 0.01); a, b, c, etc. represent one-way analysis of variance between different developmental stages of two varieties, with significant differences (Duncan’s multiple range test) assessed at the 5% confidence level. AsA, ascorbic acid; DHA, dehydroascorbic acid; T-AsA, total ascorbic acid; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.

Figure 4.

Changes in the activities of AsA-related enzymes during the development of different tissues in two jujube varieties. (A) Changes in the activities of AsA-related enzymes during fruit development of two jujube varieties. (B) Changes in the activities of AsA-related enzymes during leaf development of two jujube varieties. (C) Comparison of AsA-related enzyme activities in the petals of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (**p < 0.01), ** indicates a highly significant difference (0.01 < p* < 0.05); a, b, c, etc. represent oneway analysis of variance between different developmental stages of two varieties, with significant differences (Duncan’s multiple range test) assessed at the 5% confidence level. AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.
Changes in the activities of AsA-related enzymes during the development of different tissues in two jujube varieties. (A) Changes in the activities of AsA-related enzymes during fruit development of two jujube varieties. (B) Changes in the activities of AsA-related enzymes during leaf development of two jujube varieties. (C) Comparison of AsA-related enzyme activities in the petals of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (**p < 0.01), ** indicates a highly significant difference (0.01 < p* < 0.05); a, b, c, etc. represent oneway analysis of variance between different developmental stages of two varieties, with significant differences (Duncan’s multiple range test) assessed at the 5% confidence level. AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.

Figure 5.

Relative expression levels of genes involved in AsA metabolism during fruit development of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (0.01 < p* < 0.05), ** indicates a highly significant difference (**p < 0.01); a, b, c, etc. represent one-way analysis of variance between different developmental stages of two varieties, with significant differences (Duncan’s multiple range test) assessed at the 5% confidence level. AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GGP, GDP-L-galactose phosphorylase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; MDHAR, monodehydroascorbate reductase; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.
Relative expression levels of genes involved in AsA metabolism during fruit development of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (0.01 < p* < 0.05), ** indicates a highly significant difference (**p < 0.01); a, b, c, etc. represent one-way analysis of variance between different developmental stages of two varieties, with significant differences (Duncan’s multiple range test) assessed at the 5% confidence level. AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GGP, GDP-L-galactose phosphorylase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; MDHAR, monodehydroascorbate reductase; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.

Figure 6.

Relative expression levels of genes involved in AsA metabolism during leaf development of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (0.01 < p* < 0.05), ** indicates a highly significant difference (**p < 0.01); a, b, c, etc. represent one-way analysis of variance between different developmental stages of two varieties, with significant differences (Duncan’s multiple range test) assessed at the 5% confidence level. AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GGP, GDP-L-galactose phosphorylase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; MDHAR, monodehydroascorbate reductase; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.
Relative expression levels of genes involved in AsA metabolism during leaf development of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (0.01 < p* < 0.05), ** indicates a highly significant difference (**p < 0.01); a, b, c, etc. represent one-way analysis of variance between different developmental stages of two varieties, with significant differences (Duncan’s multiple range test) assessed at the 5% confidence level. AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GGP, GDP-L-galactose phosphorylase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; MDHAR, monodehydroascorbate reductase; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.

Figure 7.

Comparison of the expression of AsA metabolic genes in petals of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (0.01 < p* < 0.05), ** indicates a highly significant difference (**p < 0.01). AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GGP, GDP-L-galactose phosphorylase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; MDHAR, monodehydroascorbate reductase; ZM1: 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.
Comparison of the expression of AsA metabolic genes in petals of two jujube varieties. Note: * and ** indicate independent samples t-test, which analyse the differences between ZM1 and ZP in direct quantitative data at the same developmental stage. * indicates a significant difference (0.01 < p* < 0.05), ** indicates a highly significant difference (**p < 0.01). AO, ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GGP, GDP-L-galactose phosphorylase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; MDHAR, monodehydroascorbate reductase; ZM1: 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.

Figure 8.

Correlation analysis of AsA accumulation with metabolic enzyme activities and gene expression in two jujube varieties. (A) Correlation analysis of AsA accumulation with metabolic enzyme activities and gene expression during fruit development in two jujube varieties. (B) Correlation analysis of AsA accumulation with metabolic enzyme activities and gene expression during leaf development in two jujube varieties. AO, Ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; AsA, ascorbic acid; DHA, dehydroascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GGP, GDP-L-galactose phosphorylase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; MDHAR, monodehydroascorbate reductase; T-AsA, total ascorbic acid; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.
Correlation analysis of AsA accumulation with metabolic enzyme activities and gene expression in two jujube varieties. (A) Correlation analysis of AsA accumulation with metabolic enzyme activities and gene expression during fruit development in two jujube varieties. (B) Correlation analysis of AsA accumulation with metabolic enzyme activities and gene expression during leaf development in two jujube varieties. AO, Ascorbate oxidase; APX, ascorbate peroxidase; AsA, ascorbic acid; AsA, ascorbic acid; DHA, dehydroascorbic acid; DHAR, dehydroascorbate reductase; GalDH, L-galactose dehydrogenase; GalDH, L-galactose dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GalLDH, L-galactono-1,4-lactone dehydrogenase; GGP, GDP-L-galactose phosphorylase; GME, GDP-D-mannose 3',5'-epimerase; GMP, GDP-D-mannose pyrophosphorylase; GPP, L-galactose-1-P phosphatase; MDHAR, monodehydroascorbate reductase; T-AsA, total ascorbic acid; ZM1, 'Zhanshanmizao 1'; ZP, 'Zhanshanpingguozao'.

Primers for qRT-PCR_

Gene Primer sequence (5'-3') Gene Primer sequence (5'-3')
GME F:AGAATGAGCACATGACCGAAGAR:TCAGCAGCAAGGTTGAAGACA APX F:CCTGAAATCCCATTCCATCR:GCACCTTCCCAGAGTATGAC
GME1 F:GGCACCTACCATGAGATTGR:AGATGACCCATAAATTGACAG AO F:GGTGAGTGGACGGAGAAR:GGATTTACAACCCTAACATA
GMP F:GAAGGCACTTATTCTTGTCGR:GGATCATAGGTTTGTTA DHAR F:CCCTGAACCTGCCCTTGTR:CAGCGGTAACCTTCTCCC
GMP1 F:CAATAGCGATGTTATCAGTGR:GATGGCTCGTCAACCTTA MDHAR1 F:GCAAAACCTGCTGTCAGTCCCR:TCAACTCGTGCCATACGGTC
GGP F:TGAGCGTTTGCCACAGAR:ACCGTCCAACTTGATTATTT MDHAR2 F:GCCATAGCCAAAGCCACAAGGR:GAGTAGATCCACGACTATCGG
GPP F:GGTGGTGCTGTTATTGTTAR:GGTTTGAAGCTGCTACTCT
GalDH F:GGTGTTCCAAGAAATGAGTATR:CTCCTAGTCACTCTATCAGC
GalLDH F:AGCAGATTGGAGGCATTAR:CGATTGTTCCCTTAGCAGGCACCTTCCCAGAGTATGAC
Idioma:
Inglés
Calendario de la edición:
2 veces al año
Temas de la revista:
Ciencias de la vida, Botánica, Zoología, Ecología, Ciencias de la vida, otros