Glutamine (Gln) is one of the primary products of ammonia assimilation and one of the most important nitrogen donors in living organisms. As one of the most abundant free amino acids in plants, Gln provides about 28% of cellular nitrogen, along with histidine, tryptophan, asparagine, purines, pyrimidines, amino sugars and
Onion (
Nowadays, overcoming stresses has become increasingly important. Understanding the genome and stress-related gene expression will help elucidate the mechanisms of responses generated by plants under different stress conditions. Besides, determining the role of exogenous applications in stress-related gene activities will help determine applications to provide stress tolerance. This study intends to clarify the role of Gln, which is the main source of nitrogen for plants under normal conditions, in stress-related gene activation, genomic stability and plant growth under stress conditions.
The
Schematic representation of the experiment.
Treatments | |||||||||
---|---|---|---|---|---|---|---|---|---|
First stage | Control | 50 mM NaCl | 100 mM NaCl | 150 mM NaCl | 200 mM NaCl | 1 mM Gln | 2 mM Gln | 3 mM Gln | 4 mM Gln |
Second stage | 150 mM NaCl + 1 mM Gln | 150 mM NaCl + 2 mM Gln | 150 mM NaCl + 3 mM Gln | 150 mM NaCl + 4 mM Gln |
Gln, glutamine.
The number of germinating bulbs was recorded daily throughout the experiment; the germination percentage (GP), the mean germination time (MGT), the coefficient of velocity of germination (CVG), and the germination index (GI) were calculated at the end of the experiment. Shoot length (SL, mm), root length (RL, mm), shoot fresh and dry weight (SFW, SDW, g), root fresh and dry weight (RFW, RDW, g), and total number of leaves (TNLs) were measured in ten randomly selected plants from each group to determine the impact of Gln on plant growth under salinity and normal circumstances.
Germination data were calculated using the following formulas:
GP (%) = number of germinated seeds/total number of seeds × 100 (Gosh et al., 2014).
MGT: ΣD n/Σn D = days counted from the beginning of the experiment (Ellis and Roberts, 1981; Sivritepe, 2012)
D, day;
CVG: N1 + N2 + …. + Nx/100 × N1T1 + …… + NxTx (Kotowski, 1926)
GI: (14 × n1) + (13 × n2) +…..+ (1 × n14) (modified from Benech et al., 1991)
n1, n2,…, n14 – number of seeds germinated per day for 14 days from the first day of germination; 14, 13…., and 1 are the weights of the germinated seeds daily.
The determination of the pigment in onion leaf tissue exposed to salt stress and Gln was performed according to Doğanlar et al. (2010). In this context, 200 mg of fresh onion leaves were homogenised in 8 mL of 80% acetone using a Daihan HG-15-A homogeniser. The solutions were centrifuged at 3,000 rpm for 15 min. The absorbance of the supernatants was measured at 645, 652, 663 and 470 nm UV-vis spectrometer (Hitachi U-1800 spectrophotometer). Photosynthetic pigment concentrations were calculated according to the following formulas:
Total chlorophyll:
Chlorophyll a (Chl a): (11.75 ×
Chlorophyll b (Chl b): (18.61 ×
Carotenoids (Car): [(1000 ×
DNA was isolated from 100 mg of the plant samples using the GeneJET Plant Genomic DNA Purification Kit (Thermo ScientificTM, Waltham, MA, USA) according to the kit protocol. The concentration and purity of DNA were measured using a microvolume spectrophotometer (OPTIZEN, Nano Q Lite, Daejeon, Republic of Korea). As a result of DNA isolation, total DNAs obtained from the control and treatment groups were equalized with nuclease-free water before the randomly amplified polymorphic DNAs-polymerase chain reaction (RAPD-PCR) reaction and used as template DNA.
For the RAPD-PCR analysis, a total reaction volume of 40 μL was prepared in PCR tubes using Dreamtaq 2X PCR Master Mix (Thermo ScientificTM), 12 RAPD primers (Table 2) and equalised DNA samples. The reaction mixture (40 mL) for the amplification of genomic DNA is as follows: Dreamtaq 2X PCR Master Mix (20 mL), 3.85 μL of primer intermediate stocks (0.5 μM) were added for each primer and DNAs from template DNA stocks prepared at 100 ng DNA per 1 μL were brought to the final volume with nuclease-free water. PCR was performed on the Applied Biosystems® ProFlexTM PCR instrument (Waltham, MA USA). PCR was performed under PCR conditions of 1 cycle 98°C 1 min, 42 cycles 94°C 20 s, 37°C 20 s and 72°C 1 min and 1 cycle 72°C 10 min PCR conditions.
RAPD PCR primers and sequences.
Primer | Primer sequence | ||
---|---|---|---|
RAPD2 | 5′ | ACGGTACCAG | 3′ |
RAPD7 | 5′ | TTCCGAACCC | 3′ |
OPPO5 | 5′ | CCCCGGTAAC | 3′ |
OPI18 | 5′ | TGCCCAGCCT | 3′ |
12OPC06 | 5′ | GAACGGACTC | 3′ |
14OPC09 | 5′ | CTCACCGTCC | 3′ |
19OPC14 | 5′ | TGCGTGCTTG | 3′ |
21OPC16 | 5′ | CACACTCCAG | 3′ |
OPW10 | 5′ | TCGCATCCCT | 3′ |
30OPAF05 | 5′ | CCCGATCAGA | 3′ |
25OPN01 | 5′ | CTCACGTTGG | 3′ |
S237 | 5′ | ACCGGCTTGT | 3′ |
PCR, polymerase chain reaction; RAPD, randomly amplified polymorphic DNAs.
After DNA amplification, 12 μL of the PCR products and 6 μL of the DNA Ladder were loaded into wells containing 2% agarose gel + ethidium bromide and run in 2 × TAE (Tris 1.6 M, acetic acid 0.8 M, EDTA 40 mM) buffer at 70 volts for approximately four and a half hours. DNA Ladder of 100–10000 base pairs was used as a molecular weight standard according to the manufacturer’s instructions. The bands obtained were photographed using a UV transilluminator (Infinity Capture, Vilber Lourmat, Quantum, France), and the size of the bands was determined using the Bio-Profil Bio1D++ programme (Vilber Lourmat, Quantum, France) and were analysed by molecular weight (base pairs).
Genomic template stability [GTS (%)]; GTS% = [1–(a/n)] × 100 was calculated using this formula.
where
Onion leaf tissues were homogenised using the Tissue Lyser LT system (Qiagen, Germantown, Maryland, USA). The lysis process was repeated thrice until the samples were completely homogenised. Afterwards, the samples were kept at room temperature, and the RNA isolation stage was initiated.
RNA was isolated using a combination of TRIzolTM Reagent and PureLink RNA Mini Kit (Thermo Fisher Scientific, USA). The samples were brought to room temperature and placed in Bioer Thermo Shakers; 500 μL of TRIzol reagent was added and incubated at 400 rpm for 5–10 min at room temperature. Then, 100 μL of chloroform (Merck, Darmstadt, Germany) was added to these homogenised samples and incubated for 2–3 min and centrifuged at 12000 ×
In this study, the relative expression levels of
Genes, gene names, sequences and literature.
Gene ID | Gene name | Primer sequences (5→3’) | Reference |
---|---|---|---|
Superoxide dismutase | F TTCCTCCAGCATTCCCAGTG | Ghodke et al. (2020) | |
R ATGGCTTGACACATGGTGCT | |||
Superoxide dismutase 2, mitochondrial | F GGCGAAGCAAACAGCCTCAT | Ji et al. (2021) | |
R AGTATCGCCGAACGAGTGGA | |||
L-ascorbate oxidase-like | F TGATGTTTGTGCTGTCTTTCGG | Ghodke et al. (2020) | |
R ACCGTGAAAGTGTTTGTGCT | |||
DNA Polymerase Delta 1, catalytic subunit | F AGACGACTCGCTGTGTATTGCT | Lyu et al. (2020) | |
R CCAGTAACTCGTGCCATCTCCA | |||
Chaperone | F TCCTGGCAAGTCTGCTTTGA | Ghodke et al. (2020) | |
R GGCTCTAATTCCTCGCGTTT | |||
21 kDa protein | F TAGATGGATGGCGAACTCGG | Ghodke et al. (2020) | |
R TCTTCTTCTTCGCACTCCT | |||
β |
F TCCTAACCGAGCGAGGCTACAT | Sun et al. (2013) | |
R GGAAAAGCACTTCTGGGCACC | |||
18S ribosomal RNA | F GAATGACTCCTGGCAATG | Liu et al. (2015) | |
R GATTGGAATGACGCTATACA |
Protocol: Step 1 for the qRT-PCR reaction: enzyme activation: 95°C, 10 min; Step 2: denaturation: 95°C, 15 s; primer bonding-chain elongation: 60°C-1 min, Step 3: melting curve: 95°C, 15 s, 60°C, 1 min, 95°C, 15 s.
For the determination of gene expressions, cDNAs were amplified using Applied Biosystems QuantStudio 5 Real-Time PCR according to the Power Syber Green qPCR Master Mix (Thermo Scientific) protocol. Gene expressions were calculated by the 2-ΔΔCt method (Livak and Schmittgen, 2001). Endogenous control β-actin and 18S mRNA expressions were used as calibration and correction factors with the multiple control method. Protocol: Step 1 for the qRT-PCR reaction: enzyme activation: 95°C, 10 min; Step 2: denaturation: 95°C, 15 s; primer annealing chain extension: 60°C, 1 min; Step 3: melting curve: 95°C, 15 s, 60°C, 1 min, 95°C, 15 s.
Analysis of variance (ANOVA) was used in the Minitab 21 package programme (Pennsylvania, USA) to compare the mean differences between the plant growth and the germination attributes of Gln applications; the applications were compared using the Tukey test (
The analysis of GTS values was compared using SPSS 18 software at a significance level of
In the study, the difference between the means of expression values obtained by the 2-ΔΔCt method in the qRT-PCR array studies was determined by one-way ANOVA and the groups in which the means were determined by the Tukey HSD test. Analyses were performed using SPSS 20, University Licence (IBM, New York, USA), and
This part of the research was accomplished in two stages. In the first stage, a threshold value was determined according to the rate at which increasing salt levels suppressed vegetative growth. The most dramatic reduction in growth parameters was observed in plants treated with 150 mM NaCl. Shoot and RL decreased from 300.78 mm to 55.37 mm and from 335.30 mm to 54.16 mm, respectively, compared to the control. Therefore, 150 mM NaCl was defined as the threshold concentration, and the vegetative changes caused by Gln treatments in onion under salt-stress conditions were examined at this salt level.
Firstly, when the germination results were examined (Figure 1), the GP in the control experiment was 100%. In the bulbs exposed to 150 mM NaCl, it decreased to 64% and the best result was obtained from the 2 mM Gln group under salt-stress conditions (82%). Under normal conditions, 4 mM Gln application showed its positive effect by increasing the MGT (3.48 days) and GI (1.79). Under salt stress, the MGT decreased from 6.48 days to 4.51 days as a result of 2 mM Gln application, the CGV was 75.85, and the GI was 1.46, indicating that the 2 mM Gln application was the best application under salinity.
Changes in GP, MGT, CVG, and GI caused by salt stress and Gln treatments. Statistically significant differences between treatments are shown in the bar graphs with different letters. According to one-way ANOVA (Tukey test), statistically significant differences were determined between the experimental groups at the
It was determined that different Gln concentrations affected vegetative growth under unstressed and salt-stress conditions. Under unstressed conditions, 2 mM Gln increased all parameters except root characteristics above the control level. In addition, although 3 mM Gln was not as successful as 2 mM Gln in promoting plant growth, it increased the TNLs, which is an important criterion for producers, by 150.7% compared to the control group (13.7). It was also found that 3 mM Gln applied under stress conditions was the most effective concentration in reducing the negative effects of salinity. In addition to plant growth, it increased the TNLss to 6.6 and provided a 53.5% increase compared to 150 mM NaCl. The findings of the ANOVA showed that Gln had statistically significant effects on all variables (Table 4).
Changes in the vegetative growth of onions at different Gln concentrations under salt-stress and non-stress conditions.
Treatments | SL (mm) | RL (mm) | SFW (g) | RFW (g) | SDW (g) | RDW (g) | TLN (no.) |
---|---|---|---|---|---|---|---|
Control | 300.78 ab | 335.30 a | 4.7717 bc | 5.3486 a | 0.2974 b | 0.2578 b | 5.4 c |
50 mM NaCl | 200.50 abc | 174.67 b | 3.3849 c | 1.8111 bcd | 0.2423 b | 0.1269 cd | 6.0 c |
100 mM NaCl | 176.14 bcd | 99.98 bcd | 3.0034 c | 0.9761 cd | 0.3421 b | 0.0514 de | 4.7 c |
150 mM NaCl | 55.37 de | 54.16 cd | 1.6138 c | 0.7861 cd | 0.1272 b | 0.0980 de | 4.3 c |
200 mM NaCl | 35.96 e | 30.95 d | 0.6784 c | 0.2976 d | 0.1009 b | 0.0250 e | 3.6 c |
1 mM Gln | 265.67 ab | 78.67 bcd | 5.6750 abc | 2.0207 bcd | 0.3935 b | 0.1229 cd | 6.7 bc |
2 mM Gln | 316.00 a | 131.33 bc | 11.1293 a | 3.1972 b | 5.0274 a | 0.2022 bc | 11.6 ab |
3 mM Gln | 269.00 ab | 70.00 cd | 10.4772 ab | 2.8864 bc | 3.4157 a | 0.9267 a | 13.7 a |
4 mM Gln | 243.67 ab | 68.67 cd | 6.4551 abc | 2.2977 bcd | 4.5882 a | 0.2567 b | 6.6 bc |
150 mM NaCl+ 1 mM Gln | 64.67 de | 79.67 bcd | 1.3471 c | 1.8282 bcd | 0.1246 b | 0.1017 de | 3.7 c |
150 mM NaCl+ 2 mM Gln | 65.33 de | 78.00 cd | 1.6087 c | 1.3310 bcd | 0.1228 b | 0.1293 cd | 6.0 c |
150 mM NaCl+ 3 mM Gln | 81.67 cde | 84.67 bcd | 1.7282 c | 1.8951 bcd | 0.1594 b | 0.1341 cd | 6.6 bc |
150 mM NaCl+ 4 mM Gln | 77.67 cde | 64.00 cd | 0.8713 c | 1.1304 bcd | 0.1030 b | 0.1166 cde | 5.7 c |
** | ** | ** | ** | ** | ** | ** |
Statistically, the differences between the applications are shown with different letters (Tukey). **
The distribution of the treatments according to the changes in the germination and growth characteristics separately and together is presented as a linear projection in Figure 2. In addition, a heat map was used to show the distribution of the treatments with a dendrogram as well as the increase and decrease of the examined parameters according to the treatments (Figure 2). According to the germination data only, the control, 50 mM NaCl, 100 mM NaCl, Gln treatments and 150 mM NaCl + 2 mM Gln formed a separate group. According to vegetative data only, it can be seen that the control group was completely separated; on the other hand, under severe stress conditions, the Gln-treated groups and severe stress treatments were clustered. When all parameters were analysed together, it was determined that the control group was completely separated, the 150 mM and 200 mM NaCl groups were clustered and the groups treated with 1, 3 and 4 mM Gln under stress conditions were in the same group. These results are also consistent with the dendogram formed in the heat map. Furthermore, when the heat map was analysed, it was found that the control, 50 mM NaCl, 100 mM NaCl, 1 mM, 2 mM, 3mM and 4 mM Gln groups were separated from the others in terms of both germination and vegetative development, and good results were obtained. Besides, the closest application to this large group was the 150 mM NaCl + 2 mM Gln.
Linear projection of the distribution of applications according to plant growth and germination values and visualisation of the classification of applications according to the change in plant characteristics with heat map. (A) Linear projection according to germination attributes, (B) linear projection according to germination and vegetative attributes (C) heat map. By using the principal component analysis data in linear projection (A and B), a two-dimensional projection is presented in which different applications are best separated according to variables. As it can be followed from the scale on the heat map (C), the change of colours gives information about the effect of the applications on the variables. The lowest values are shown in dark blue. The change of colour towards white in the heat map showed that the values increased.
In this context, the contents of the total Chl, Chl a, Chl b and Car, which are informative parameters under stress conditions, were examined (Figure 3). Under normal conditions, the application of Gln did not increase the levels of total Chl, Chl a, Chl b and Car above the control plants. Although the Chl a/b ratio increased in all the Gln applications compared to the control group, it reached its highest value in the 3 mM and 4 mM Gln application groups. Under salt-stress conditions, it was found that the photosynthetic pigment content was enhanced in all the Gln applications compared to the 150 mM NaCl group. It was found that the application of 4 mM Gln (total Chl: 2.81 mg · g–1 TA, Car: 0.49 mg · g–1 TA) gave the best results, especially in terms of total Chl and Car.
Total Chl, Chl a, Chl b, Chl a/b and carotenoid amounts determined in leaf tissues of control and experimental groups of onion. Data are given as mean ± standard deviation,
RAPD analysis was performed to assess the impact of Gln, applied under salinity conditions, on the stability of the genomic template of the onion. In the current study, increased stress intensity caused DNA damage and decreased GTS. The sequences of 8 different primers (Figure 4) that gave significant results from 12 primers used in the determination of DNA polymorphisms in plant samples are presented in Table 2. The gel images of these primers are given in Figure 4, and also the gel images of the 4 monomorfic primers that were not included in the analysis. The graph showing the genomic pattern stability (GTS) in the control and treatment groups is shown in Figure 5. The GTS was determined in the experimental groups in comparison to the control plants according to the number of bands they gave. The highest band changes and the lowest GTS among the groups were found in the 150 mM NaCl group with 59 ± 7.56% (
Gel image of the primers included in the analysis. (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln, 11: 150 mM NaCl + 2 mM Gln, 12: 150 mM NaCl + 3 mM Gln, 13: 150 mM NaCl + 4 mM Gln). L (Ladder): Fermantas zip ruler DNA ladder 100 bp.
GTS in the control and treatment groups.
In this study, the expression levels of
Relative fold increased values of antioxidant defence genes
Gln is one of the most plentiful free amino acids in plants, acting as a nitrogen and ammonium transporter in the synthesis of nitrogenous organic substances such as proteins and nucleotides. The effects of exogenous applications of Gln, which functions as an important metabolic fuel in plants in natural conditions, on plant growth and metabolism have not been fully elucidated yet, and there are restricted studies on this subject. Moreover, the limited number of researches have reported that Gln also plays a role in metabolic pathways responsible for the stress response under stress circumstances (Kan et al., 2015; Han et al., 2022). Onion, which has a relatively small genome (2n = 16), is a suitable material for studies to understand the stress mechanism (Alam et al., 2023). Therefore, in the current study, the onion was used to understand the morphological, genomic and transcriptomic effects of Gln on plant metabolism under both salt-stress and normal conditions. In a study investigating the effects of different amino acids on germination and growth parameters of onion, the positive effect of Gln was noted. Gln enhanced the GP of onion under stress-free conditions and promoted root and shoot elongation (Abdelkader et al., 2023). In the present research, the vegetative development of onions after exogenous Gln applications is consistent with the results obtained from genomic stability and transcriptomic analysis and is compatible with the above-mentioned functions of Gln. In the non-stress condition, 2 mM Gln had a stimulating effect on the above-the-ground parts of the plants. This resulted in a considerable improvement, particularly in fresh shoot weight and leaf number. It was also found that the application of 2 mM Gln to all vegetative parameters reversed the adverse impact of stress in plants exposed to salinity (150 mM NaCl) (Table 2). The GP was not altered by the Gln application under unstressed conditions. However, it was increased 2-fold, and the MGT was shortened under salinity (Figure 1). Moreover, the TNL, which is an important yield criterion in onions, increased in both stressed and non-stressed conditions compared to the control group. The effects of Gln application on germination vary depending on whether the plant is in a salt-stressed or non-stressed condition, as well as on the application concentration and genotype. In a study conducted with different carrot cultivars, although the pre-application of Gln had no effect on the germination properties of orange carrot under unstress circumstances, a concentration of 1 mM Gln had a positive influence on the germination characteristics under salinity (Üstüner et al., 2023). Moreover, the increase in the amount of chlorophyll and carotenoids (Figure 3) and the improvement in genomic stability (Figure 4) in stressful situations have proven that Gln plays a critical role in the nutritional and metabolic activities in current research. Similarly, Abdelkader et al. (2023) showed that Gln priming under stress-free conditions increased the amount of carotene in onion by 50%. This result obtained in onion was also shown in rice and poplar (Kan et al., 2015; Han et al., 2022) and supports the view of Gln as a potential nitrogen source, as the researchers stated.
The stimulating effects of exogenously applied Gln
Different concentrations of Gln treatment under salt-stress conditions caused transcriptional upregulation of different stress-related genes. The 2 mM Gln concentration caused a rise in the expression of the
SOD is a primary defence mechanism responsible for maintaining intracellular homeostasis by preventing the accumulation of radicals in cells under stress conditions (Kumar et al., 2020). SODs, which protect plant cells from oxidative damage, are localised in different regions of the cell. CuZn-SOD is found in the chloroplast, cytosol and extracellular space, whereas Mn-SOD is mainly found in mitochondria and peroxisomes (Kumar et al., 2013; Del Río and López-Huertas, 2016). It was found that CuZn-SOD and APX gene transfer into salt-sensitive sweet potato and overexpression of these genes increased tolerance to salt stress (Yan et al., 2016). A linear relationship was found between increasing salinity in rice and the transcription of the
Gln, a precursor molecule in the synthesis of nitrogenous organic substances, has been shown to activate some genes responsible for intracellular signalling under stress conditions. In this study, the changes caused by Gln application in the expression of some genes involved in stress response in onion under normal and salt stress conditions were investigated in relation to germination and vegetative development. It was found that pre-treatment with Gln under salt stress conditions had a positive effect on all germination parameters. Although pre-application of Gln did not have an important effect on germination under normal conditions, it supported the vegetative development and increased the number of leaves, which is an important yield criterion especially in onions. The number of leaves, which was 5.4 in the control, increased by more than two-fold to 13.6 with Gln application. Under salt stress, Gln supported the development of the above-the-ground plant organs and increased the photosynthetic pigment content and genomic pattern stability at all application concentrations (80%). Transcriptional induction of stress-relevant genes in the presence of Gln under salt stress remained at a lower expression level except for