Acceso abierto

First characterisation of chrysanthemum virus B infecting chrysanthemum in Thailand and development of colourimetric RT-LAMP for rapid and sensitive detection

Salit Supakitthanakorn
Salit Supakitthanakorn
, 
Tomofumi Mochizuki
Tomofumi Mochizuki
, 
Kanjana Vichittragoontavorn
Kanjana Vichittragoontavorn
, 
Kaewalin Kunasakdakul
Kaewalin Kunasakdakul
, 
Pilunthana Thapanapongworakul
Pilunthana Thapanapongworakul
 y 
On-Uma Ruangwong
On-Uma Ruangwong
   | 19 ago 2022
Folia Horticulturae's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Article Category: Original Article
Publicado en línea: 19 ago 2022
Páginas: 151 - 161
Recibido: 17 mar 2022
Aceptado: 01 jul 2022
DOI: https://doi.org/10.2478/fhort-2022-0012
Palabras clave
© 2022 Salit Supakitthanakorn et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

Symptoms observed on chrysanthemum leaves collected from Chiang Mai Province of Thailand that were positive to CVB detection by using RT-PCR. (A) Chlorosis and yellowing symptoms (the red arrow). (B) The mild mottling symptom. CVB, chrysanthemum virus B; RT-PCR; reverse transcription polymerase chain reaction.
Symptoms observed on chrysanthemum leaves collected from Chiang Mai Province of Thailand that were positive to CVB detection by using RT-PCR. (A) Chlorosis and yellowing symptoms (the red arrow). (B) The mild mottling symptom. CVB, chrysanthemum virus B; RT-PCR; reverse transcription polymerase chain reaction.

Figure 2

Colour-coded pairwise identity matrix generated from 35 virus sequences consisting of CVB isolates, other members of the genus Carlavirus and CMV of the genus Cucumovirus that was used as the outgroup. CVB isolates in this study were indicated by red boxes. The pairwise identity matrix was performed in the SDT version 1.2 program. The colour of the cell indicates the percentage identity score between two sequences (left and bottom axis) according to the colour-coded cells mean to each cell in the SDT matrix of the Figure 2. CMV, cucumber mosaic virus; CVB, chrysanthemum virus B; SDT, sequence demarcation tool.
Colour-coded pairwise identity matrix generated from 35 virus sequences consisting of CVB isolates, other members of the genus Carlavirus and CMV of the genus Cucumovirus that was used as the outgroup. CVB isolates in this study were indicated by red boxes. The pairwise identity matrix was performed in the SDT version 1.2 program. The colour of the cell indicates the percentage identity score between two sequences (left and bottom axis) according to the colour-coded cells mean to each cell in the SDT matrix of the Figure 2. CMV, cucumber mosaic virus; CVB, chrysanthemum virus B; SDT, sequence demarcation tool.

Figure 3

The phylogenetic relationship of CVB-BW-54 and CVB-HL4-70 (the red box) and members of the genus Carlavirus based on nucleotide sequences of the CP gene. CMV (accession №. AJ242585.1) was used as the outgroup. Multiple sequence alignments and construction of the phylogenetic tree were generated by ClustalW by the ML method with 1,000 replicates of bootstrap values performed by MEGA X program. CMV, cucumber mosaic virus; CP, coat protein; ML, maximum likelihood.
The phylogenetic relationship of CVB-BW-54 and CVB-HL4-70 (the red box) and members of the genus Carlavirus based on nucleotide sequences of the CP gene. CMV (accession №. AJ242585.1) was used as the outgroup. Multiple sequence alignments and construction of the phylogenetic tree were generated by ClustalW by the ML method with 1,000 replicates of bootstrap values performed by MEGA X program. CMV, cucumber mosaic virus; CP, coat protein; ML, maximum likelihood.

Figure 4

Diagram of LAMP primers’ attachment on the partial ORF4 (TGB3 gene) and ORF5 (CP gene) of CVB genome. All four LAMP primers including FIP (containing F2 and F2c), BIP (containing B2 and B1c), F3 and B3 were highlighted with different colours. BIP, backward inner primer; B3, backward primer; CVB, chrysanthemum virus B; FIP, forward inner primer; F3, forward primer; LAMP, loop-mediated isothermal amplification.
Diagram of LAMP primers’ attachment on the partial ORF4 (TGB3 gene) and ORF5 (CP gene) of CVB genome. All four LAMP primers including FIP (containing F2 and F2c), BIP (containing B2 and B1c), F3 and B3 were highlighted with different colours. BIP, backward inner primer; B3, backward primer; CVB, chrysanthemum virus B; FIP, forward inner primer; F3, forward primer; LAMP, loop-mediated isothermal amplification.

Figure 5

Optimisation of RT-LAMP for detection of CVB. (A) Optimisation of temperature at 60 °C, 63 °C, 65 °C and 68 °C for 60 min. (B) Optimising time of incubation at 65 °C for 30 min, 45 min and 60 min. CVB, chrysanthemum virus B; M, DNA ladder; NC, negative control (nuclease-free water).
Optimisation of RT-LAMP for detection of CVB. (A) Optimisation of temperature at 60 °C, 63 °C, 65 °C and 68 °C for 60 min. (B) Optimising time of incubation at 65 °C for 30 min, 45 min and 60 min. CVB, chrysanthemum virus B; M, DNA ladder; NC, negative control (nuclease-free water).

Figure 6

Sensitivity test of LAMP in the detection of CVB compared with RT-PCR detection. (A) LAMP-AGE (top) with the LOD at 10−9 diluted plasmid and colourimetric LAMP (bottom). (B) PCR with LOD at 10−3 diluted plasmid. AGE, agarose gel electrophoresis; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; LOD, limits of detection; M, DNA ladder; NC, negative control (nuclease-free water); PCR, polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction.
Sensitivity test of LAMP in the detection of CVB compared with RT-PCR detection. (A) LAMP-AGE (top) with the LOD at 10−9 diluted plasmid and colourimetric LAMP (bottom). (B) PCR with LOD at 10−3 diluted plasmid. AGE, agarose gel electrophoresis; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; LOD, limits of detection; M, DNA ladder; NC, negative control (nuclease-free water); PCR, polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction.

Figure 7

Specificity assay and evaluation of colourimetric RT-LAMP for detection of CVB. (A) The LAMP product was observed only in the lane of CVB. (B) Evaluation of colourimetric RT-LAMP for detection of CVB from random chrysanthemum samples. (C) RT-PCR detection. CChMVd, chrysanthemum chlorotic mottle viroid; CSVd, chrysanthemum stunt viroid; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; Lanes 1–10, chrysanthemum samples; M, DNA ladder; MYSV, melon yellow spot virus; NC, negative control (nuclease-free water); PC, positive control; RT-PCR, reverse transcription polymerase chain reaction; TMV, tobacco mosaic virus; TuMV, turnip mosaic virus.
Specificity assay and evaluation of colourimetric RT-LAMP for detection of CVB. (A) The LAMP product was observed only in the lane of CVB. (B) Evaluation of colourimetric RT-LAMP for detection of CVB from random chrysanthemum samples. (C) RT-PCR detection. CChMVd, chrysanthemum chlorotic mottle viroid; CSVd, chrysanthemum stunt viroid; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; Lanes 1–10, chrysanthemum samples; M, DNA ladder; MYSV, melon yellow spot virus; NC, negative control (nuclease-free water); PC, positive control; RT-PCR, reverse transcription polymerase chain reaction; TMV, tobacco mosaic virus; TuMV, turnip mosaic virus.

Symptoms induced by CVB on indicator plants after mechanical inoculation.

Indicator plants Symptoms
Inoculated leaf Upper leaf
Chenopodium amaranticolor CS –
C. quinoa CS –
Chrysanthemum × morifolium – Y
Nicotiana benthamiana – M, Ma
N. glutinosa NS –
N. tabacum cv. Xanthi – M, Ma
N. tabacum cv. Samsun NS –
Petunia × hybrida – M, Ma
Vigna uniculata – –

Primers used for detection of CVB by RT-PCR and colourimetric RT-LAMP techniques in this study.

Type of detection Primer name Sequence (5′-3′) Target gene(s) Ta*** (°C) Reference
PCR CVB-F1CVB-R1 AGTCACAATGCCTCCCAAACCATACCTTTCTTAGAGTGCTATGCT TGB3** + CP 54 Guan et al. (2017)
PCR and sequencing CVB-upCVB-dw TAGGTTGTGGAGTGGTTACAATCTTCACAATGACATCCAT CP 56 Lin et al. (2005)
LAMP FIP*BIPF3B3 CCTGCTCACGCTCTCGTTCCCAGCTCGAACAGCGGAAGAGATGAACTCCAATGCCCCAGCTAGTGCCGCGAGTTGTGTACCAACTCCACCTCCACCTCGTCTTGCTCTCTCCTCAG TGB3 + CP 63–68 This study
eISSN:
2083-5965
Idioma:
Inglés
Calendario de la edición:
2 veces al año
Temas de la revista:
Life Sciences, Plant Science, Zoology, Ecology, other
RSS Feed de revista