Physiological role of Prion Protein in Copper homeostasis and angiogenic mechanisms of endothelial cells
Categoría del artículo: Research Article
Publicado en línea: 24 abr 2019
Páginas: 57 - 70
DOI: https://doi.org/10.2478/ebtj-2019-0007
Palabras clave
© 2019 Lidia De Riccardis, Francesca Rizzo, Emanuela Urso, Valeria Garzarelli, Vincenza Intini, Marco Greco, Maria Chiara Maffia, Antonio Danieli, Michele Maffia, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.
The prion protein (PrP) is known for its involvement in regenerative processes including adhesion, proliferation, differentiation and angiogenesis (1); in addition, it is mostly known for its role in prion diseases, where its misfolding and aggregation can cause fatal neurodegenerative conditions such as the bovine spongiform encephalopathy, scrapie of sheep and human Creutzfeldt – Jakob disease (2).
The protein contains several high affinity binding sites for copper ions (3) and its structure evolved from a common ZIP (Zrt-and Irt - like protein) ancestor gene (4). PrP structure consists of a C-terminal globular domain and an N-terminal flexible tail, containing two charged clusters (CC1 and CC2), the octarepeat region (OR) and a hydrophobic domain (HD) (5). At the C-terminus, two N-glycosylation sites are located in the globular domain (6, 7, 8). PrP is located extracellularly in the lipid rafts, anchored to the outer lipidic monolayer by the glycosyl-phosphatidylinositol (GPI) anchor (5). Thanks to a rapid constitutive clathrin-/cavolein-dependent process (9, 10, 11), PrP is endocyted and then recycled or degraded (12,13). The protein can also regulate intracellular copper content through its ability to bind the metal ions and promote their endocytosis (14, 15, 16, 17). In fact, the histidine residues present at the PrP N-terminal domain can bind up to 6 copper ions with low affinity (18, 19, 20) triggering their cellular internalization at the synaptic cleft (9,12,21,22). However, PrP role in copper uptake is still debated due to contrasting data (23).
Copper plays an essential role in many biological processes, also due to its redox ability of changing between oxidized (Cu2+) and reduced state (Cu+). Under physiological condition, copper concentration is strictly regulated; copper deficiency or genetic mutation of metal ions transporters could lead to developmental defects (24,25); on the other hand, its excess would increase free radicals toxic concentrations and cause oxidative damage within the cell (24,26).
The expression of PrP in microvascular brain endothelial cells has been demonstrated by several authors (27,28), also within the human placenta, suggesting the importance of this protein in the angiogenetic process and in regulating copper metabolism during the development of the foeto-maternal circulatory system (29). The hypoxic microenvironment of early gestation (29) may stimulate PrP expression through HIF-1α, as its silencing down-regulates PrP expression under hypoxia (30, 31, 32), by means of an SP1 (specific protein 1) transcription factor-dependent mechanism (33, 34, 35, 36, 37). Recent evidence links vascular dysfunctions and neurodegenerative conditions demonstrating how an altered copper supply can be a triggering factor (38,39) and supporting the AD “two-hit vascular hypothesis”, where a cerebrovascular damage (
In this work we were able to demonstrate, for the first time, the functional expression of PrP in HUVEC (human umbelical vein endothelial cells). Therefore, we investigated the physiological role of PrP and copper ions in the angiogenetic processes by using an
The endothelial cell model used in the present study is represented by the HUVEC (Human Umbilical Vein Endothelial Cells) primary cell line. Cells were isolated by digestion of endothelial fractions derived from the umbilical cord vein collecting in the Gynecology and Obstetrics unit of the “Vito Fazzi” hospital in Lecce, within 24 hours from their withdrawal. Informed consent was obtained from each subject, according to the declaration of Helsinki. The umbilical cords have been preliminarily treated with a disinfectant solution, then washed with PBS (Sigma-Aldrich, Milan) containing antibiotics (Penicillin/Streptomycin; Sigma-Aldrich) and an antimycotic (Amphotericin B) and then perfused by cannulation to remove blood residues. Collagenase IV solution (0.1% in PBS, Sigma-Aldrich) was then injected into the vein. Umbilical cords were transferred to the incubator (37 ° C) for 20 minutes, in order to allow the enzymatic digestion. The endothelial fraction was collected in a Falcon tube containing bovine fetal serum (FBS; Sigma- Aldrich) and cell suspension was centrifuged for 8 minutes at 1000 g. The pellet was washed twice in PBS and cells were resuspended in fresh culture medium (M199 Euroclone, Life Science Division) and seeded in pre-treated 0.2% gelatin/PBS T25 flasks. For experimental tests, endothelial cells were used within two and four passages.
Cells were plated into 96-well trays and 0.5 mg/ml MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; Sigma-Aldrich] was added to cell cultures for 3 h at 37°C. The MTT formazan product was released from cells by adding dimethylsulfoxide and measured spectrophotometrically at 570 nm (44). The percent of survival was assessed by comparison with untreated cultures. The estimation of viable cells is expressed as a percentage of the optical density values acquired compared to the controls.
RNA extraction from cells grown at 70–80% confluence was performed by using the TRIzol reagent (Invitrogen, Milan, Italy), accordingly to the manufacturer’s instructions. Total RNA (0.5 μg) was reverse-transcribed with random hexamers in a 20 μl reaction volume by the GeneAmp Gold RNA PCR kit (Perkin-Elmer, Monza, Italy). Amounts of cDNA template from 0.2 to 0.5 μg were needed for real-time PCR analysis. Primers and annealing sequences are listed in
Real-time PCR primer sequences and conditions
Target gene (host) | GenBank no. accession | Primers (sense, antisense) | Tm (°C) | bp |
---|---|---|---|---|
GADPH ( | NM_017008 | Fw 5’-CTGCTCCTCCCTGTTCTAGAGACA-3’ | 58 | 105 |
PrPC ( | NM_000311.3 | Rv 5’-CTCCCAGTCGTTGCCAAAAT -3’ | 56 | 117 |
KDR ( | NM_002253 | Rv 5’- GGCTCTTTCGCTTACTGTTC -3’ | 62 | 114 |
Flt-1 ( | NM_002019 | Rv 5’-GGTGTGCTTATTTGGACATC-3’ | 58 | 306 |
The cell lysis protocol was applied to semi-confluent monolayers, performing all operations on ice. Preliminarily two washes with PBS were carried out, after which the cell lysis was performed in RIPA buffer (Tris-HCl 50 mM, pH 7.4, NP-40 1%, Sodium-deoxycholate 0.25%, NaCl 150 mM, EDTA 1 mM, PMSF 1 mM, Na3VO4 1 mM; 0.5 ml for 106 cells). Protein extracts (~30 μg) were boiled in Laemmli sample buffer (Sigma-Aldrich) for 5 min, resolved on 10% SDS-polyacrylamide gels and transferred onto nitrocellulose membranes at 190 mA for 1.5 h. Membranes were blocked for 1 h in Tris-buffered saline (TBS), 0.05% Tween-20, 5% non-fat dry milk, followed by overnight incubation with specific primary antibodies diluted in the same buffer. The primary antibodies used are: anti-PrP (1:8000, Sigma-Aldrich) and anti-β-actin (1:8000, Sigma-Aldrich). After washing with 0.1% Tween in TBS, membranes were incubated with a peroxidase-conjugated secondary antibody for 1 h, washed and developed using the ECL chemiluminescent detection system (Clarity™ Western ECL Substrate Biorad). The densitometric analyses of blots were performed by a computerized image processing system (Image J, 1.0 version).
PrP-targeting siRNAs have been provided from Ambion (Life Technologies Italia, Monza, MB) in the Silencer® Select Pre-Designed & Validated formulation. In particular, we used two different siRNAs (ID s11212, s11213) for the target gene (PRNP), one scrambled siRNA as negative control and the transfectant agent siPORT NeoFXTM (Ambion), preliminarily diluted in OPTI-MEM® I (Invitrogen), at reduced culture medium serum content, in order to vehicle them into the cell.
The gene silencing experiments were set up in 12-well plates and each of the experimental conditions listed as follow were tested in duplicate: control (incubation with the transfectant agent in the absence of siRNA), negative control (transfection with 30 nM scrambled siRNA), transfection with siRNA ID 11212 30 nM, transfection with siRNA ID 11213 30 nM, simultaneous transfection with the two siRNAs, both tested at concentration of 15 nM. After a short incubation period, the siRNA/siPORT NeoFX complexes transfection agents were distributed in the multi-well plate (100μL/well) immediately before cell seeding. The expression levels of the prion protein were analyzed by Western Blotting after 48 h from transfection.
Confluent HUVEC cell cultures seeded in a 12-well plate have been used for membrane Cu2+-reductase activity assay. Monolayer cells have been washed with PBS and incubated for 3-15 min at 37°C, with HBSS buffer containing Cu-His2 (10-50 μM) and the copper ions chelation agent bathocuproine-disulfonic acid disodium salt (BCS; Sigma-Aldrich, Milano) 200 μM. The BCS-Cu+ complex formation (molar extinction coefficient ε = 12.25 mM-1 cm-1) within the cell culture medium has been assessed by spectrophotometer reading at λ = 482 nm. Data have been normalized on the cell lysate protein content of each well.
The kinetics of Cu intake were studied in HUVEC control and PrPKD cells using the green-fluorescent heavy metal indicator Phen Green SK diacetate (PG SK) λexc = 506 nm, λem = 530 nm; Molecular Probes, Invitrogen). Cells were harvested and then dye-loaded by incubation for 10 min at 37°C in HBSS (in mM: 140 NaCl, 5 KCl, 1 Na2HPO4, 1 CaCl2, 0.5 MgCl2, 5 D-glucose, 10 Hepes; pH 7.4) containing 1 μM PG SK. After loading, cells were washed twice by centrifugation and then resuspended in the physiological buffer cited above. For each evaluation, an aliquot of cells (3 x 104) was introduced in a cuvette housed in a LS-50B Perkin-Elmer spectrofluorometer, after the preheating of the sample compartment at 37°C. Once the emission signal of the probe ‘‘entrapped’’ within the cells was stable, Cu chloride was added at different concentrations (0–5 μM) and the fluorescence quenching (
The HUVEC control and silenced cells (since now on referred to as PrPKD cells) at the same number of passages were trypsinized and resuspended in the M199 culture medium at a density of 70.000 cells/ml. The “hanging drop method” (46) was used to generate the “spheroids pendant”. 5 ml of sterile PBS were introduced on the bottom of 60 mm plates in order to create “wet rooms”. Spheroids growth was monitored and images were acquired by an inverted optical microscope in contrast phase mode, at regular intervals of time (0-48 h).
50 μL of Matrigel (BD Biosciences) with reduced growth factor content was deposited on the bottom of pre-cooled 96-well plates. In order to allow matrix polymerization, the plates were transferred to 37° C for 2 hours. HUVEC control and PrPKD cells were, therefore, seeded at a density of 5000 cells/cm2 and stimulated with VEGF 10ng/ml for 16h. The formation of capillary-like structures was evaluated by observation via an inverted optical microscope in contrast phase mode. The characteristics of the networks (percentage area covered by cells, tubule extension, number of nodes) were analyzed using the WimTube software (Wimasis GmbH, Munich, Germany).
Results are presented as means ± SE and each experiment has been done at least in triplicate. Statistical comparisons have been made by Student’s t test and ANOVA followed by Dunnett’s post-test. Significance was demonstrated at p<0.05 (*), p <0.01 (**).
In order to understand the contribution of PrP in the processes of endothelial activation we used a RNA interference (RNAi) protocol.
The experimental procedure associated with RNAi could cause cellular stress and cytotoxicity, masking the specific effect of the PrP gene down-regulation. In order to critically evaluate this aspect and to avoid the use of toxic amount of transfectant agent, cellular viability assays have been performed. As shown in

After these preliminary assessments, we proceeded to the preparation of the knockdown cultures used for subsequent evaluations. HUVEC cells were transfected with siRNA s11212 and s11213 (used individually or mixed according to the concentrations already mentioned), capable of recognizing different sequences of the PrP transcript. The silencing efficiency rate was checked 2 days after transfection by Real Time PCR analysis (

In parallel, immunoblotting assay was performed to check the reduction of the PrP protein expression levels (
The HUVEC control and PrPKD cells were exposed for 24 hours to increasing copper concentrations and cell viability was measured by MTT assay. The cytotoxicity profiles reported in

According to current hypothesis, copper ions are reduced (Cu+) before being translocated through the membrane. In the light of
The absorbance values of the culture medium after incubation showed a marked but still not significant reduction of about 30% in HUVEC PrPKD with respect to the control cells. As reported in

PrP usually undergoes recycling between the plasmatic membrane and the endosomal district; so, we decided to investigate any possible association between protein internalization process and copper transport in HUVEC cells. These cells were pre-treated with two different endocytosis inhibitors, Cytochalasin B and Chlorpromazine separately, and exposed for a short time to hypertonic shock in order to evaluate the copper transport activity in different experimental conditions. The cells previously incubated with the Phen Green SK fluorescent dye and were exposed to Cu2+ 20 μM (

The use of a cell culture protocol in suspension for the generation of spheroids, allowed us to evaluate the ability of PrPKD cells to establish stable interactions with other cellular and extracellular matrix elements. As shown in


HUVEC control and PrPKD cells were seeded at the same density on a thin layer of Matrigel without growth factors and then stimulated with VEGF 10 ng/ml for 16h to induce the formation of a vascular-like network.


Copper is an essential micronutrient, necessary for the proper growth, development and maintenance of connective tissue, bone, brain and heart and it has been shown to promote endothelial cell proliferation, mobilization and morphogenesis (48,49). It has been reported that copper can induce angiogenesis by activating various compounds, which include angiogenin (50) and tumour necrosis factor alpha (TNFα) (51,52). Furthermore, the silencing of CTR1 (copper transporter 1) using siRNA in copper-exposed HUVEC cell lines, inhibited the angiogenesis and reduced the vascular endothelial growth factor (VEGF) expression (53).
The prion protein seems to play a fundamental role in the etiology of various neurodegenerative disorders. At this regard, PrP protein abundantly expressed in the central nervous system and at lower levels in non-neuronal cells (including immune system cells), is known for its role in prion pathologies, such as Creutzfeldt-Jacobs disease occurring both in humans and animals (54, 55, 56). The N-terminal octapeptide domains of the PrP protein can bind up to four copper ions (one for each octa-repeat region). In particular, the amino-terminal domain and the so-called “fifth site”, consisting of histidine residues 96 and 111, each binding a copper ion, represent the candidate sites able to bind the substrate (Cu2+) (18, 22).
Endothelial cells express and present PrP on their surface (35). PrP has been reported to be a component of caveolae that take part to the signal transduction involved in cell survival, differentiation and angiogenesis (59). Satoh et al. have also seen that the disruption of the PrP gene results in an abnormal regulation of cell proliferation, differentiation and survival processes, including Ras and Rac pathways taking part to angiogenesis (60). In addition, PrP transcripts are expressed in the endothelial cells during the development of the neonatal brain, indicating a role in the angiogenesis of the central nervous system (CNS) and in the blood-brain barrier maturation (60, 61). Neurovascular dysfunctions have been identified as the primary cause of cognitive deterioration in neuro-degenerative diseases (39); it is also known that a reduced copper availability in nervous system may lead to the development of lesions at the CNS level (24, 62, 63). On the other hand, dysomehostasis of copper ions and ceruloplasmin was found in Multiple Sclerosis patients (64). It is interesting to point out how recent experimental evidences identified the brain endothelium as a tissue able to preserve any variations in the systemic copper level or, at least, to be able to act as a sensor of copper bioavailability (38). Few neurophysiology and neuroimaging studies have also placed a link between trace elements involved in reduction-oxygenation cell processes and/or oxidative cell stress modulation and neurodevelopmental disorders such as Tourette syndrome (65, 66, 67).
Reduced copper availability has also been proposed as a reason for occlusion of cerebral arterial vessels in Alzheimer’s Disease (AD) patients that can evolve in thrombotic manifestations (68,69).
Several lines of evidence suggest the PrP involvement in both physiological and pathological endothelial functions during the gestation period: in particular, PrP is expressed during early embryogenesis and could be a good candidate as a pre-dictory marker in preeclampsia (28). About it, PrP overexpression in preeclamptic placenta may represent a compensatory response in order to overcome the preeclamptic condition (27).
In this work we demonstrated PrP expression in HUVEC endothelial cell lines and tried to establish: i. whether PrP can contribute to the endothelial function maintenance through copper availability modulation, and/or ii. to prove its involvement in cellular architecture and in adhesive cellular properties; both aspects were investigated in the HUVEC endothelial model, in which the expression of PrP was silenced by an RNA interference approach. The knockdown cells did not show any significant change in the proliferation rate under standard culture conditions (
The expression of PrP is strictly related to the copper availability as also shown from previous studies (20). Despite PrP ability to bind copper, the functional significance of this interaction is still unclear. In our work, HUVEC PrP-knockdown cells exhibited a reduced copper uptake (
In order to study a possible role of PrP in the morphogenetic mechanisms, we set up spheroids formation and tubulogenic assays. The spheroids formation depends on the cellular ability to replicate even in absence of an anchoring surface, and their three-dimensionality critically depends on the cell capacity to create cell-to-cell adhesions and to synthetize extracellular matrix. In our work the reduced expression of PrP protein results in spheroids showing irregular morphology, which underwent a disaggregation process (
PrP has adhesion and transport functions because of the chance to establish homophilic interactions (PrP-PrP) (72) with other adhesion proteins (13,73), and to influence their localization at the plasma membrane level (e.g. E-cadherin) (72). Current knowledge of PrP function in vascular remodeling is incomplete, and other studies seem to neglect the involvement of this protein in the angiogenic regulation of copper homeostasis, pointing out its significance in cell-to-cell and cell-to-ECM (extracellular matrix) interactions. The tubulogenesis assay of HUVEC PrP-knockdown cells in presence of VEGF165 and matrigel, showed a reduction of their sprouting capacity (
Altogether we demonstrate the functional expression of PrP in HUVEC cells and its role in copper reduction and cellular uptake. PrP is also involved in angiogenic processes as proved by its function in morphognesis of endothelial cells and in their ability to tubulogenesis. By virtue of all these properties, PrP can provide a link with the pathogenetic mechanism involved in vascular homeostasis.