Preterm respiratory distress syndrome (RDS), characterized by immature lung development, has been a severe problem for preterm infants
Long non-coding RNAs (lncRNAs) could modulate gene expression at the post-transcription level by depredating or translating target mRNAs
Previous studies have indicated that the components of peripheral cord blood are important clues for the identification of neonatal diseases
This prospective study enrolled 15 premature infants who were admitted to Jiangyin People’s Hospital of Nantong University between April 2019 and October 2019.
Peripheral blood samples (2ml for each person) were collected from all infants between 1 and 6 hours after birth. Among them, it should be noted that, for RDS patients, samples were drawn before PS replacement. All blood samples were frozen in the −80°C refrigerator following a specific process which includes centrifugation at 3,000 × g for 10 min at 4°C and then separation of clear upper liquid into an RNase-free tube. Total RNA was then extracted from the blood samples using the TRIzol reagent according to the manufacturer’s instructions and a previous study
The expression profile of the lncRNAs were analyzed by Deseq package (Affymetrix Inc., US). Samples were hybridized on the Human Clariom D (Thermo Fisher Scientific) gene chip. Background-adjustment, normalization, and log-transformation of signals intensity were performed with the Signal Space Transformation-Robust Multi-Array Average algorithm (RMA). Raw data were analyzed by the transcriptome analysis console (TAC) 4.0 software (Applied Biosystems, Foster City, CA, USA) awaiting further analysis
For lncRNA expression analysis, total RNA was transcripted to cDNA using a Reverse Transcription Kit (PrimeScript RT Master Mix, Takara Bio Inc., Otsu, Japan), then real-time quantitative PCR (qRT-PCR) validation was performed using the SYBR method (SYBR® Premix Ex Taq™, Takara Bio Inc., Otsu, Japan) according to the product instructions. An aliquot of 1 µg total RNA was added to each reaction mixture. qRT-PCR was performed on an ABI 7500 thermal cycler (Applied Biosystems; Thermo Fisher Scientific, Inc. US) with SYBR Green (Roche Diagnostics Co., Ltd. GER). The thermocycling conditions were as follows: 95°C for 5 min, followed by 40 cycles of 95°C for 20 sec and 55°C for 20 sec. At the end of each run, a melting curve analysis was performed at 72°C to monitor primer dimers and formation of non-specific products. For data analysis, the comparative Ct method (2ΔΔCt) was used. Results were expressed as fold changes of gene expression adjusted to housekeeping gene GAPDH
The primers sequence for qPCR
ENST00000470527.1 | Forward | TGGAATTCGATGGGAACTTT |
Reverse | GTCTCGTCCTGGATTGAAGG | |
ENST00000504497.1 | Forward | TCGATTCTCCTGTCAGTGAAC |
Reverse | AATGTTTCCAGAGCACCACT | |
ENST00000417781.5 | Forward | GTTGATCGATCCAAGGTCGT |
Reverse | GCCTGGAATCCCAGCATTT | |
ENST00000440408.5 | Forward | TGCTTGGACAACAGACATGA |
Reverse | GAAGCAATGTAATCCCAGCA | |
GAPDH | Forward | AACTTTGGCATTGTGGAAGG |
Reverse | GGATGCAGGGATGATGTTCT |
Multivariate statistical analysis was used to calculate the Pearson correlation coefficient between differentially expressed lncRNAs and mRNAs. The greater the correlation coefficient, the greater possibility that there was a regulatory relationship between certain lncRNAs and mRNAs. The co-expression network was constructed with the Pearson correlation coefficient
GO and KEGG pathway analysis were applied to predict functions of the differentially expressed genes. The GO project offers a controlled vocabulary to label gene and gene product attributes in any organism (geneontology.org). GO results were mainly classified into three subgroups namely biological process, cellular component, and molecular function. GO analysis provides an interpretation of the relevance of genes differentially expressed between the groups. Fisher’s exact test and the χ2 test were performed to calculate the P-value and false discovery rate of each GO term function. KEGG (
For clinical results (clinical characteristics), data were analyzed using SPSS 17.0 software. Quantitative data are expressed as mean ± standard deviation (SD). One-way variance analysis was applied to detect differences among the three groups. In terms of qualitative data, the Pearson Chi-square test was performed. Significant differences were considered as
This present study was comprised of 15 premature infants in total, 5 cases without RDS for control (named as Group 1, G1), 5 cases with mild RDS (named as Group 2, G2) and 5 with severe RDS (named as Group 3, G3). The recruitment procedures are shown in
Clinical characteristics of the three groups
Gestational age (week) | 32.54±2.35 | 32.14±3.47 | 31.11±1.15 | 0.66 |
Birth weight (g) | 1654.00±540.81 | 1622.00±503.16 | 1473.00±274.94 | 0.81 |
Apgar score at 5 min | 9.20±0.84 | 8.40±1.14 | 8.40±1.14 | 0.41 |
Male (%) | 40.00 | 40.00 | 20.00 | 0.78 |
Cesarean section (%) | 40.00 | 40.00 | 60.00 | 0.80 |
Twins (%) | 20.00 | 0 | 20.00 | 0.62 |
Gestational diabetes (%) | 60.00 | 40.00 | 40.00 | 0.80 |
Without glucocorticoid usage before delivery (%) | 40.00 | 20.00 | 40.00 | 0.78 |
Quantitative data are represented as mean ± SEM. G1 was infants without RDS, G2 was infants with mild RDS and G3 was infants with severe RDS.
Affymetrix Human GeneChip was utilized to determine the expression spectrum of lncRNAs. As a result, the G1 vs. G2 comparison showed a total of 10112 differentially expressed lncRNAs, while the G2 vs. G3 comparison showed a total of 4663 differentially expressed lncRNAs. Of them, 135 lncRNAs were indicated to be differentially expressed among all three groups (G1, G2, and G3) after fold-change filtering (adjusted
The differentially expressed lncRNAs (Fold change> 2)
ENST00000417781.5 | CSE1L-AS1 | Up | chr20 | − |
ENST00000418924.6 | RIN3 | Up | chr14 | + |
ENST00000440408.5 | TTTY15 | Up | chrY | + |
ENST00000467315.5 | PFKL | Up | chr21 | + |
ENST00000470527.1 | CACHD1 | Up | chr1 | + |
ENST00000481985.5 | RPL3 | Up | chr22 | − |
ENST00000488606.5 | MRPS15 | Up | chr1 | − |
ENST00000497617.1 | TSFM | Up | chr12 | + |
ENST00000504497.1 | DMXL1 | Up | chr5 | + |
ENST00000530931.1 | CD82 | Up | chr11 | + |
ENST00000460278.5 | ANKRD28 | Down | chr3 | − |
ENST00000544168.5 | AKT1 | Down | chr14 | − |
ENST00000611549.4 | RAP1GAP | Down | chr1 | − |
ENST00000491117.5 | GNA12 | Down | chr7 | − |
ENST00000610076.1 | KCNT2 | Down | chr1 | − |
ENST00000601034.2 | INTS6-AS1 | Down | chr13 | + |
ENST00000570265.5 | C15orf41 | Down | chr15 | + |
ENST00000592944.1 | ITGA2B | Down | chr17 | − |
ENST00000494731.5 | ZDHHC20 | Down | chr13 | − |
ENST00000628791.1 | AC093495.1 | Down | chr3 | + |
Furthermore, differentially expressed mRNAs were compared for target prediction. Of them, the comparison between G1 and G2 showed a total of 2520 differentially expressed mRNAs, while the comparison between G2 and G3 showed a total of 530 mRNAs. The comparison of the three groups showed a total of 616 differentially expressed mRNAs. The lncRNA-mRNA co-expression network was constructed and showed a complex interaction between lncRNAs and mRNAs. Our analysis finally identified a total of 278 mRNAs closely related to 108 upregulated lncRNAs and 27 downregulated lncRNAs. These mRNAs with FC> 2 are shown in
The differentially expressed mRNAs (Fold change> 2)
AC027796.3 | ENSG00000262304.2 | Up | chr17 | − |
AQP7 | ENSG00000165269.12 | Up | chr9 | − |
ARNT2 | ENSG00000172379.20 | Up | chr15 | + |
DGCR6 | ENSG00000183628.12 | Up | chr22 | + |
GRID2IP | ENSG00000215045.8 | Up | chr7 | − |
MICU3 | ENSG00000155970.11 | Up | chr8 | + |
MROH7-TTC4 | ENSG00000271723.5 | Up | chr1 | + |
RHOXF1 | ENSG00000101883.4 | Up | chrX | − |
ZNF683 | ENSG00000176083.17 | Up | chr1 | − |
AC046185.1 | ENSG00000125695.12 | Down | chr17 | − |
AC137834.1 | ENSG00000258830.1 | Down | chr12 | − |
AL136295.1 | ENSG00000254692.1 | Down | chr14 | − |
BLOC1S5-TXNDC5 | ENSG00000259040.5 | Down | chr6 | − |
CTSV | ENSG00000136943.10 | Down | chr9 | − |
CYP3A5 | ENSG00000106258.13 | Down | chr7 | − |
GABRE | ENSG00000102287.18 | Down | chrX | − |
GSTM5 | ENSG00000134201.10 | Down | chr1 | + |
KCNT2 | ENSG00000162687.16 | Down | chr1 | − |
MRAP2 | ENSG00000135324.5 | Down | chr6 | + |
MYZAP | ENSG00000263155.5 | Down | chr15 | + |
PKDCC | ENSG00000162878.12 | Down | chr2 | + |
PPP1R14C | ENSG00000198729.4 | Down | chr6 | + |
SH3D19 | ENSG00000109686.17 | Down | chr4 | − |
SLC2A14 | ENSG00000173262.11 | Down | chr12 | − |
GO and KEGG analysis were further performed to annotate the biological functions of differentially expressed mRNAs. The GO analysis indicated that the mRNAs co-expressed with 108 upregulated lncRNAs were associated with 247 GO terms. The top 25 enriched terms are shown in
Additionally, a KEGG pathway analysis was performed to investigate the possible roles of the lncRNA-associated mRNA genes. The most significant pathways enriched in the set of upregulated protein-coding genes included PI3 kinase/Akt (PI3K-Akt), RAS, and mitogen-activated protein kinase (MAPK) signal pathways, while the most significant KEGG pathways of the downregulated protein-coding genes were mainly related to metabolic pathways, etc. The bubble diagrams of the top KEGG pathways of mRNAs co-expressed with upregulated and downregulated lncRNAs are shown in
Following the screening, four lncRNAs including ENST00000470527.1, ENST00000504497.1, ENST00000417781.5, and ENST00000440408.5 were further confirmed by qRT-PCR. Compared with G2 and G1, the expression levels of these four lncRNAs were increased in G3, which is consistent with the results of RNA sequencing. The relative expression levels are shown in
In-depth bioinformatics analysis of lncRNAs showed all the four lncRNAs were involved in the MAPK signaling pathway by down-regulating gene
In addition, three of lncRNAs including ENST00000417781.5, ENST00000470527.1, and ENST00000504497.1 could target the RAS signaling pathway by up-regulating
RDS is one of the most common respiratory disorders in preterm infants, which can induce acute respiratory failure
LncRNAs are related to many biologic processes, such as cell differentiation and proliferation
Interestingly, we found that the expression level of lncRNA ENST00000470527.1, ENST00000504497.1, ENST00000417781.5, and ENST00000440408.5 was increased in the plasma of RDS patients, compared with non-RDS controls. Additionally, the level of those four lncRNAs was significantly higher in the severe patients, compared with the mild RDS group. The above results suggest that these four lncRNAs were possibly related to the severity of RDS.
A few studies have investigated lncRNA ENST00000440408.5, also known as Testis-specific transcript Y-linked 15 (TTTY15). A study reported by Zhang et al. demonstrated that TTTY15 knockdown can protect cardiomyocytes against hypoxia-induced apoptosis and mitochondrial energy metabolism dysfunction in vitro through the let-7i-5p/TLR3/NF-κB pathway
To our knowledge, the other three lncRNAs (ENST00000470527.1, ENST00000504497.1, and ENST00000417781.5) were reported for the first time. Bioinformatics analysis showed that they may be associated with PI3K-Akt, RAS, MAPK, and TGF-β signaling pathways, which could regulate lung development and PS secretion. Furthermore, the process of transdifferentiation from alveolar epithelial type II to type I cells is also controlled by TGF-β and BMP signaling pathways
There were several limitations in our study. Firstly, the sample size is relatively small, a larger sample study could validate the results further. Secondly, the specific functions of four differentially expressed lncRNAs should be deeply explored in future studies to clarify the pathogenesis of RDS.
135 lncRNAs were differentially expressed among non-RDS group, mild RDS group and severe RDS group. LncRNA-mRNA co-expression networks further identified a total of 278 mRNAs that were closely related to the above differentially expressed lncRNAs. Among them, the differential expression of ENST00000470527.1, ENST00000504497.1, ENST00000417781.5, and ENST00000440408.5 were confirmed by qRT-PCR. The above results could provide a new sight for researching the potential pathophysiological mechanisms of RDS.