<abstract xmlns="http://www.w3.org/1999/xhtml">

<sec><h3>Introduction</h3>
<p>Burn infection due to <italic>Pseudomonas aeruginosa</italic> poses a considerable challenge in terms of graft loss, systemic sepsis, prolonged hospital stays, and even enhanced mortality. The aim of this study was to consider the susceptibility pattern to antibiotics and occurrence of class I, II, and III integrons in <italic>P. aeruginosa</italic> isolated from hospitalized burn patients.</p>
</sec>
<sec><h3>Materials and Methods</h3>
<p>A cross-sectional study was performed on 70 <italic>P. aeruginosa</italic> isolates obtained from blood, wounds, biopsy, and sputum samples from burn patients between January 2020 and March 2021 from different wards of a teaching hospital in Ahvaz, Iran.</p>
</sec>
<sec><h3>Results</h3>
<p>Antimicrobial susceptibility pattern was performed using the disk diffusion method. Also, PCR was carried out for the detection of <italic>intI1</italic>, <italic>intI2</italic> and <italic>intI3</italic> genes. Among the 70 <italic>P. aeruginosa</italic> isolates, 34 (48.6%) isolates were obtained from females and 36 (51.4%) isolates from males. PCR amplification revealed that 51.4% isolates (36/70) had <italic>intI1</italic>, 30% isolates (21/70) had <italic>intI2</italic>, and 12.9% isolates (9/70) had both genes. However, the <italic>intI3</italic> gene was not detected in any isolates. Furthermore, there is no important association between resistance to antibiotics and the presence of <italic>intI</italic> genes.</p>
</sec>
<sec><h3>Conclusion</h3>
<p>According to our results, there were no statistically significant differences among resistance to antibiotics and the presence of <italic>intI and intI1</italic> genes. However, the surveillance of patterns of antibiotic resistance and investigation into the role of integrons in controlling the scattering of antibiotic-resistant genes are recommended.</p>
</sec>
</abstract>

Introduction
Burn infection due to Pseudomonas aeruginosa poses a considerable challenge in terms of graft loss, systemic sepsis, prolonged hospital stays, and even enhanced mortality. The aim of this study was to consider the susceptibility pattern to antibiotics and occurrence of class I, II, and III integrons in P. aeruginosa isolated from hospitalized burn patients.

Materials and Methods
A cross-sectional study was performed on 70 P. aeruginosa isolates obtained from blood, wounds, biopsy, and sputum samples from burn patients between January 2020 and March 2021 from different wards of a teaching hospital in Ahvaz, Iran.

Results
Antimicrobial susceptibility pattern was performed using the disk diffusion method. Also, PCR was carried out for the detection of intI1, intI2 and intI3 genes. Among the 70 P. aeruginosa isolates, 34 (48.6%) isolates were obtained from females and 36 (51.4%) isolates from males. PCR amplification revealed that 51.4% isolates (36/70) had intI1, 30% isolates (21/70) had intI2, and 12.9% isolates (9/70) had both genes. However, the intI3 gene was not detected in any isolates. Furthermore, there is no important association between resistance to antibiotics and the presence of intI genes.

Conclusion
According to our results, there were no statistically significant differences among resistance to antibiotics and the presence of intI and intI1 genes. However, the surveillance of patterns of antibiotic resistance and investigation into the role of integrons in controlling the scattering of antibiotic-resistant genes are recommended.

Investigation of antimicrobial susceptibility, class I, II, and III integrons among clinical isolates of <italic>Pseudomonas aeruginosa</italic> from hospitalized burn patients in Southern Iran

Department of Microbiology, Falavarjan Branch

Postępy Higieny i Medycyny Doświadczalnej

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Investigation of antimicrobial susceptibility, class I, II, and III integrons among clinical isolates of  from hospitalized burn patients in Southern Iran

Introduction
Burn infection due to Pseudomonas aeruginosa poses a considerable challenge in terms of graft loss, systemic sepsis, prolonged hospital stays, and...

Antibiotic		intI1- positive n = 36 No. (%)	intI1- negative n = 34 No. (%)	P-value
Piperacillin/tazobactam	Resistant	34 (94.4)	31 (91.2)	0.59
Piperacillin/tazobactam	Susceptible	2 (5.6)	3 (8.8)	0.59
Ceftazidime	Resistant	29 (80.6)	32 (94.1)	0.09
Ceftazidime	Susceptible	7 (19.4)	2 (5.9)	0.09
Imipenem	Resistant	35 (97.2)	31 (91.2)	0.27
Imipenem	Susceptible	1 (2.8)	3 (8.8)	0.27
Ciprofloxacin	Resistant	30 (83.3)	27 (79.4)	0.67
Ciprofloxacin	Susceptible	6 (16.7)	7 (20.6)	0.67
Gentamicin	Resistant	35 (97.2)	33 (97)	0.96
Gentamicin	Susceptible	1 (2.8)	1 (3)	0.96

Gene type	Primer/Sequence (5′ 3′)	Product Size (bp)	References
IntI1	F:GGTCAAGGATCTGGATTTCG	483	[38]
IntI1	R:ACATGCGTGTAAATCATCGTC	483	[38]
IntI2	F:CACGGATATGCGACAAAAAGGT	789	[38]
IntI2	R:GTAGCAAACGAGTGACGAAATG	789	[38]
IntI3	F:AGTGGGTGGCGAATGAGTG	580	[38]
IntI3	R:TGTTCTTGTATCGGCAGGTG	580	[38]

Antibiotics		intI2 - positive n = 21 No. (%)	intI2 - negative n = 49 No. (%)	P-value
Piperacillin/tazobactam	Resistant	19 (90.5)	46(93.9)	0.61
Piperacillin/tazobactam	Susceptible	2 (9.5)	3 (6.1)	0.61
Ceftazidime	Resistant	20 (95.2)	41 (83.7)	0.18
Ceftazidime	Susceptible	1 (4.8)	8 (16.3)	0.18
Imipenem	Resistant	19 (90.5)	47 (95.9)	0.36
Imipenem	Susceptible	2 (9.5)	2 (4.1)	0.36
Ciprofloxacin	Resistant	15 (71.4)	42 (85.7)	0.15
Ciprofloxacin	Susceptible	6 (28.6)	7 (14.3)	0.15
Gentamicin	Resistant	20 (95.2)	47 (95.9)	0.89
Gentamicin	Susceptible	1 (4.8)	2 (4.1)	0.89

Investigation of antimicrobial susceptibility, class I, II, and III integrons among clinical isolates of Pseudomonas aeruginosa from hospitalized burn patients in Southern Iran

Article Category: Original Study

Publicado en línea: 14 mar 2024

Páginas: 170 - 175

Recibido: 10 abr 2022

Aceptado: 31 mar 2023

DOI: https://doi.org/10.2478/ahem-2023-0011

Palabras clave
Pseudomonas aeruginosa, antibiotic resistance, integron, burn patients

© 2023 Rezvan Mirzaei et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Frequency of antibiotics resistance pattern in intI1-positive and -negative among P. aeruginosa isolates

Primers used in the study

Frequency of antibiotic resistance pattern in intI2-positive and negative among P. aeruginosa isolates

Investigation of antimicrobial susceptibility, class I, II, and III integrons among clinical isolates of Pseudomonas aeruginosa from hospitalized burn patients in Southern Iran

Article Category: Original Study

Publicado en línea: 14 mar 2024

Páginas: 170 - 175

Recibido: 10 abr 2022

Aceptado: 31 mar 2023

DOI: https://doi.org/10.2478/ahem-2023-0011

Palabras clavePseudomonas aeruginosa, antibiotic resistance, integron, burn patients

© 2023 Rezvan Mirzaei et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Frequency of antibiotics resistance pattern in intI1-positive and -negative among P. aeruginosa isolates

Primers used in the study

Frequency of antibiotic resistance pattern in intI2-positive and negative among P. aeruginosa isolates

Palabras clave
Pseudomonas aeruginosa, antibiotic resistance, integron, burn patients