In their excellent contribution to the systematics of the superfamily Hemicycliophoroidea Skarbilovich, 1959 (Siddiqi, 1980), Chitambar and Subbotin (2014) reviewed the taxonomy of the genus
There are 12 species of
Several soil samples were collected from date palm and fruit tree gardens in Khuzestan and Gilan provinces, Iran. The relevant information of the presently studied nematode populations, and those included in phylogenetic analyses, are given in Table 1. Jenkins’ method (Jenkins, 1964) was used to extract the nematodes from soil samples. The collected specimens were killed in hot 4% formaldehyde solution and transferred to anhydrous glycerin according to De Grisse (1969). Observations and measurements were conducted using a Leitz SM-LUX light microscope equipped with a drawing tube. Some of the specimens were photographed using an Olympus DP72 digital camera attached to an Olympus BX51 light microscope equipped with differential interference contrast (DIC).
Information of the species/populations of
GenBank accession numbers | |||||
---|---|---|---|---|---|
Species | Host | Locality | D2-D3 of LSU rDNA | ITS | Reference or identifier |
|
|
Khuzestan province, Iran | MT901580, MT901581 | MT901582, MT901583 | Present study |
|
|
Yolo County, CA, USA | KF430518, KF430519 | KF430576 | Subbotin et al. (2014) |
|
|
Gilan province, Iran | – | MT901584 | Present study |
|
Unknown plant | Belgium | FN433875 | – | I. Tandingan De Ley et al. (unpub.) |
|
Turf grasses | Football pitch, Madrid, Spain | KF430447 | KF430580 | P. Castillo; Subbotin et al. (2014) |
|
Unknown plant | Clallam County, WA, USA | KF430448 | KF430579 | Subbotin et al. (2014) |
|
Peat | South Africa | MT329669, MT329670 | MT329671, MT329672 | M. Rashidifard (unpub.) |
|
|
Serranova, Brindisi, Italy | KF430512 | – | Subbotin et al. (2014) |
|
|
S. Barrameda, Cádiz, Spain | – | KF430608 | Subbotin et al. (2014) |
|
|
Epiros, Greece | – | KF430606 | Subbotin et al. (2014) |
|
|
Lake City, FL, USA | KF430506 | KF430536 | Subbotin et al. (2014) |
|
|
Hamilton City, Glenn County, CA, USA | KF430480 | KF430562 | Subbotin et al. (2014) |
|
|
Butte City, Glenn County, CA, USA | KF430481 | – | Subbotin et al. (2014) |
|
Unknown plant | Brooklyn Park, MN, USA | KF430482 | – | Subbotin et al. (2014) |
|
Unknown plant | California, USA | – | FN435301 | I. Tandingan De Ley et al. (unpub.) |
|
Unknown plant | Sacramento County, CA, USA | – | MG019827 | Van den Berg et al. (2018) |
|
|
Taylors Mistake, New Zealand | KF430444, KF430445 | KF430582, KF430583 | Subbotin et al. (2014) |
|
|
Filippias, Epirus, Greece | KF430453 | KF430584 | Subbotin et al. (2014) |
|
|
Arroyo Frío, Jaén, Spain | KF430461 | KF430539, KF430540 | Subbotin et al. (2014) |
|
|
Hinojos, Huelva, Spain | KF430462 | – | Subbotin et al. (2014) |
|
|
Santa Elena, Jaén, Spain | KF430463 | KF430541 | Subbotin et al. (2014) |
|
|
Zapponeta, Foggia, Italy | KF430458 | – | Subbotin et al. (2014) |
|
|
South Korea | MK305971, MK305972 | MK305973, MK305974 | Mwamula et al. (2020) |
|
Unknown plant | Gauteng province, South Africa | GQ406240, GQ406241 | GQ406237 | Van den Berg et al. (2010) |
|
Turf grasses | Madrid, Spain | KF430454 | – | Subbotin et al. (2014) |
|
|
Cádiz, Spain | – | KF430537, KF430538 | Subbotin et al. (2014) |
|
|
Moguer, Huelva, Spain | KF430521 | KF430578 | Subbotin et al. (2014) |
|
|
Moguer, Huelva, Spain | KF430449, KF430450 | KF430587, KF430588 | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
Turf grasses | New Hanover County, NC, USA | KF430501 | – | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
Turf grasses | Carteret County, NC, USA | KF430502 | – | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
Bentgrass | Texas, USA | KC329574 | KC329575 | Ma and Agudelo (2015) |
|
|
Punta Gorda, FL, USA | MG019825 | – | Van den Berg et al. (2018) |
|
|
Paines Praire, FL, USA | – | KF430524, KF430526 | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
Turf grasses | New Hanover County, NC, USA | – | KF430528 | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
|
Monterey County, CA, USA | KF430432, KF430434 | KF430598 | Subbotin et al. (2014) |
|
Turf grasses | San Francisco, CA, USA | MG019815 | – | Van den Berg et al. (2018) |
|
Unknown plants | Marin County, CA, USA | MG019816 | – | Van den Berg et al. (2018) |
|
|
Santa Rosa, CA, USA | – | KF430590 | Subbotin et al. (2014) |
|
|
Argentina | – | KF430596 | Subbotin et al. (2014) |
|
|
San Francisco, CA, USA | – | KF430600 | Subbotin et al. (2014) |
|
Grasses | Sacramento County, CA, USA | KF430520 | KF430577 | Subbotin et al. (2014) |
|
Turf grasses | Brunswick, NC, USA | KF430488, KF430492 | – | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
Turf grasses | Indian Hills, CA, USA | KF430491 | – | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
Turf grasses | San Antonio, TX, USA | – | KF430544 | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
|
St Augustine, FL, USA | – | KF430550 | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
|
Fort Lauderdale, FL, USA | – | KF430552 | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
Grasses | Chemba District, Mozambique | MG019824 | – | Van den Berg et al. (2018) |
|
|
Cartaya, Huelva, Spain | KF430465 | – | Subbotin et al. (2014) |
|
|
Zhejiang Province, China | MG701275–MG701277 | MG701272, MG701273 | Maria et al. (2018) |
|
|
Moscow, Russia | KF430469–KF430471 | KF430570–KF430572 | Subbotin et al. (2014) |
|
|
Castillo de Locubin, Jaén, Spain | – | KF430568 | Subbotin et al. (2014) |
|
|
La Rambla, Córdoba, Spain | KF430452 | KF430581 | Subbotin et al. (2014) |
|
Grasses | Gauteng province, South Africa | KF430515 | KF430603 | Subbotin et al. (2014) |
|
Sugarcane | South Africa | – | GQ406238, GQ406239 | Van den Berg et al. (2010) |
|
|
Carnota, Coruña, Spain | – | KF430542 | Subbotin et al. (2014) |
|
|
Monteagudo Isl., Pontevedra, Spain | KF430459, KF430460 | – | Subbotin et al. (2014) |
|
|
South Carolina, USA | – | JQ708147 | Cordero López et al. (2013) |
|
Unknown plant | Iran | KY284835 | – | E. Miraeiz, R. Heydari (unpub.) |
|
Grasses | Terovo, Epirus, Greece | AY780974 | KF430602 | Subbotin et al. (2005); Subbotin et al. (2014) |
|
Unknown plant | Birdlings Flat, New Zealand | KF430516, KF430517 | KF430609, KF430610 | Subbotin et al. (2014) |
|
|
Tingle Farms, Willcox, AZ, USA | – | KF430573, KF430574 | Subbotin et al. (2014) |
|
Turf grasses | Carteret County, NC, USA | – | KF430575 | Subbotin et al. (2014) |
|
|
Kaitoke Waterworks, New Zealand | KF430446 | KF430585, KF430586 | Subbotin et al. (2014) |
|
|
Almonte, Huelva, Spain | KF430451 | KF430589 | Subbotin et al. (2014) |
|
Unknown plant | Henrieville, UT, USA | KF444173 | – | Subbotin et al. (2014) |
|
Turf grasses | Monterey, CA, USA | KF430494 | KF430559 | Subbotin et al. (2014) |
|
|
Preveza, Greece | KF430509, KF430511, KF430514 | KF430605 | Subbotin et al. (2014) |
|
|
Jaroslavl region, Russia | – | KF430604 | Subbotin et al. (2014) |
|
Unknown plant | Brake, Germany | AY780973 | – | Subbotin et al. (2005); Subbotin et al. (2014) |
|
|
Yolo County, CA, USA | KF430483, KF430485–KF430486 | KF430566, MG019828 | Subbotin et al. (2014); Van den Berg et al. (2018) |
|
|
Paines Prairie, FL, USA | KF430493 | KF430557, KF430558 | Subbotin et al. (2014) |
|
Grasses | Saint Paul, MN, USA | KF430474 | – | Subbotin et al. (2014) |
|
Unknown plant | Brooklyn Park, MN, USA | KF430475 | – | Subbotin et al. (2014) |
|
Unknown plant | Sedona, AZ, USA | KF430476 | – | Subbotin et al. (2014) |
|
|
Los Angeles County, CA, USA | KF430507, KF430508 | – | Subbotin et al. (2014) |
|
Unknown plant | Vicinity of Trois–Rivières, Quebec, Canada | MG019819 | – | Van den Berg et al. (2018) |
|
Unknown tree | east of Temecula, CA, USA | MG019818 | MG019829 | Van den Berg et al. (2018) |
|
Unknown tree | Pismo Beach, San Luis Obispo County, CA, USA | – | MG019830 | Van den Berg et al. (2018) |
|
Unknown plant | Vicinity of Quebec City, Quebec, Canada | MG019820 | – | Van den Berg et al. (2018) |
|
|
Taiwan | – | EU247525 | Chen et al. (2008) |
|
Unknown plant | Monopoli, Italy | AY780943 | – | Subbotin et al. (2005) |
|
|
Taiwan | – | EF126180 | Chen et al. (2009) |
|
Unknown plant | Niebüll, Germany | AY780946 | – | Subbotin et al. (2005) |
|
|
Crystal river, Florida, USA | – | JN112261 | Tanha Maafi et al. (2012) |
Note: 1Originally identified as
Specimens preserved in glycerin were selected for observation according to Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded mixture of ethanol-acetone series, critical point-dried with liquid carbon dioxide, and coated with gold. The mounts were examined with a Zeiss Merlin microscope (5 kV).
For molecular analyses, single female specimens were picked out, examined in a drop of distilled water on a temporary slide under the light microscope, transferred to 3 μl of TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0) on a clean slide, and then crushed using a cover slip. The suspension was collected by adding 20 μl TE buffer. One DNA sample for the Gilan population and two DNA samples for the Khuzestan population were prepared in this manner. The DNA samples were stored at –20°C until used as a PCR template. Primers for LSU rDNA D2-D3 amplification were forward primer D2A (5’–ACAAGTACCGTGAGGGAAAGT–3’) and reverse primer D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (Nunn, 1992). Primers for amplification of ITS rDNA were forward primer TW81 (5’–GTTTCCGTAGGTGAACCTGC–3’) and reverse primer AB28 (5’–ATATGCTTAAGTTCAGCGGGT–3’) as described in Vovlas et al. (2008). The 25 μl PCR mixture contained 14.5 μl of distilled water, 3 μl of 10 × PCR buffer, 0.5 μl of 10 mM dNTP mixture, 1.5 μl of 50 mM MgCl2, 1 μl of each primer (10 pmol/μl), 0.5 μl of
Morphometrics of
Character | Female holotype | Female paratypes | Juvenile |
---|---|---|---|
n | 1 | 20 | 1 |
L | 868.7 | 830.3 ± 48.3 (767–893) | 600 |
a | 22.2 | 21.5 ± 2.1 (17.9–24.5) | 18.0 |
b | 5.9 | 5.8 ± 0.3 (5.4–6.5) | 4.8 |
c | 10.7 | 10.1 ± 1.2 (8.3–11.5) | 9.8 |
c' | 2.9 | 3.0 ± 0.3 (2.5–3.5) | 2.6 |
o | 11.5 | 12.2 ± 0.9 (9.4–15.3) | 9.0 |
DGO | 7.9 | 8.1 ± 0.9 (7.4–10.0) | 5.5 |
V | 85.5 | 84.1 ± 0.9 (82.6–85.5) | – |
St | 68.4 | 66.5 ± 2.3 (63.3–71.0) | 60.8 |
m | 81.5 | 80.6 ± 1.4 (77.4–83.7) | 80.7 |
Stylet knob height | 4 | 4.1 ± 0.5 (4–5) | 3.8 |
Stylet knob width | 7 | 6.6 ± 0.7 (6–8) | 6.6 |
Excretory pore from anterior end | 171 | 168.3 ± 6.1 (159–180) | 168 |
Diam. at mid-body | 39 | 38.4 ± 3.6 (32–46) | 33 |
Diam. at anus (ABD) | 27 | 26.8 ± 1.7 (24–29) | 23 |
Diam. at vulva | 38 | 38.4 ± 2.1 (35–43) | – |
Vulva-anterior body distance | 744 | 700 ± 43 (653–751) | – |
Vulva-tail terminus distance | 125 | 129.5 ± 6.0 (113–142) | – |
Spermatheca-vulva distance | 89 | 87.6 ± 13.2 (74–121) | – |
Lip diam. | 15 | 15.7 ± 0.9 (14–18) | 14 |
Lip height | 7 | 6.7 ± 0.7 (6–9) | 6 |
First body annulus diam. | 16 | 16.9 ± 0.9 (15–19) | 15 |
Second body annulus diam. | 18 | 18.6 ± 1.1 (16–21) | 16 |
Pharynx length | 145 | 142.6 ± 4.8 (134–151) | 125 |
Annulus width | 4 | 4.1 ± 0.3 (3.4–4.7) | 2.8 |
Tail length | 81 | 83.3 ± 7.9 (74–92) | 61 |
V-anus distance | 45 | 47.9 ± 9.9 (32–64) | – |
R | 245 | 221.3 ± 8.6 (212–247) | 216 |
RSt | 19 | 19.5 ± 1.1 (18–21) | 22 |
Rph | 41 | 41.1 ± 3.2 (35–48) | 46 |
Rex | 48 | 47.4 ± 3.6 (42–50) | 58 |
RV(ant) | 193 | 185.3 ± 8.4 (167–198) | – |
RV | 52 | 47.8 ± 6.9 (38–59) | – |
RVan | 15 | 15.0 ± 3.8 (10–22) | – |
Ran | 37 | 32.9 ± 4.9 (25–47) | – |
VL/VB | 3.3 | 3.4 ± 0.3 (2.8–3.9) | – |
Spermatheca length | 29 | 19.8 ± 5.4 (14–29) | – |
Spermatheca diam. | 15 | 15.5 ± 1.6 (12–22) | – |
St%L | 7.8 | 7.9 ± 0.4 (7.5–8.4) | 10 |
The newly obtained sequences of the D2-D3 fragments of LSU rDNA of the both populations, and the selected sequences from GenBank, were aligned by Clustal X2 (
The Bayesian analysis was performed to infer the phylogenetic trees using MrBayes v3.1.2 (Ronquist and Huelsenbeck, 2003), running the chains for two million generations. After discarding burn-in samples and evaluating convergence, the remaining samples were retained for further analyses. The Markov chain Monte Carlo (MCMC) method within the Bayesian framework were used to determine equilibrium distribution and help estimate the posterior probabilities of the phylogenetic trees (Larget and Simon, 1999) using the 50% majority rule. Bayesian posterior probability (BPP) values higher than 0.50 are given on appropriate clades. The output files of the phylogenetic program was visualized using Dendroscope v3.2.8 (Huson and Scornavacca, 2012) and re-drawn in CorelDRAW software version 17.
Body straight to slightly ventrally arcuate following heat fixation. Cuticular sheath closely appressed over entire or most of body. Under LM, annuli rounded, with or without longitudinal lines, appearing as blocks mostly in the distal body region. Block-like differentiations are more prominent in distal body region under SEM. Lateral field with no longitudinal lines, but having broken or continuous striae or anastomoses. Amphidial openings large, partly plugged. Lip region continuous with body contour, bearing one wide annulus. Labial disc slightly elevated. Stylet with posteriorly sloping knobs, having moderate to large cavity at base. Pharynx criconematoid, with pharyngeal corpus absent, metacorpus (median bulb) ovoid bearing central valves, short isthmus surrounded by the nerve ring and reduced pyriform basal bulb. Cardia short, surrounded by intestinal tissue. Excretory pore five to 10 annuli posterior to the pharynx base. Hemizonid indistinct. Reproductive system monodelphic-prodelphic, outstretched, composed by long ovary with oocytes arranged in one or two rows, spermatheca round to oval, filled with spheroid sperm cells, vulva with not or slightly modified lips, vulval sleeve slightly elongate, one to two annuli long. Body portion behind vulva slightly narrowing towards distal region. Distance between vulva to anus about five anal body diam. Tail conoid, symmetrically narrowing at about 35% of its length at distal region to form a narrower conical section ending to a finely rounded to sharp terminus.
Not found.
One juvenile specimen was found in the population that is similar to female except by a smaller body size and undeveloped sexual organs.
This population was recovered from the rhizospheric soil of date palm (
The specific epithet of the new species refers to the original city name in Latin where it was discovered.
The holotype and 12 paratype females were deposited into the nematology laboratory of the Department of Plant Protection, Shahid Chamran University of Ahvaz, Ahvaz, Iran. Three paratype females deposited at the Wageningen Nematode Collection (WaNeCo), Wageningen, The Netherlands. Two paratype females deposited at the Nematode Collection of the Department of Animal Biology, Plant Biology and Ecology of the University of Jaén, Jaén, Spain. The ZooBank Life Science Identifier (LSID) for this publication is as follows: http://zoobank.org/urn:lsid:zoobank.org:pub:EEF9C9E9-90B8-4EC1-8BD9-A403FD8D58E4.
In general morphology, the new species is close to
From
From
From
From
From
From
From
Morphometrics of
Reference | Present study | Loof (1984) | |
---|---|---|---|
Province | Gilan province | East Azarbaijan province | |
Character | Female | Male | Female |
n | 10 | 5 | 11 |
L | 912.0 ± 21.4 (881–928) | 809.0 ± 13.6 (795–822) | 820–1020 |
a | 21.2 ± 2.5 (18.6–24.3) | 37.3 ± 5.7 (31.8–43.3) | 26–30 |
b | 5.3 ± 0.2 (5.2–5.6) | – | 5.0–5.6 |
c | 11.6 ± 2.0 (10.1–14.5) | 8.2 ± 0.4 (7.8–8.6) | 9.7–13.6 |
c' | 2.3 ± 0.4 (1.7–2.6) | 5.2 ± 0.5 (4.6–5.6) | – |
V | 86.7 ± 1.0 (85.5–87.6) | – | 86–89 |
St | 92.5 ± 2.1 (90–97) | – | 90–103 |
m | 78.3 ± 4.0 (75.3–84.2) | – | – |
Stylet knob height | 5.0 ± 0.4 (4.3–5.6) | – | – |
Stylet knob width | 7.8 ± 0.5 (6.9–8.6) | – | – |
Excretory pore from anterior end | 178.0 ± 8.9 (169–192) | 140.2 ± 13.4 (127–164) | – |
Diam. at mid-body | 43.5 ± 5.5 (38–50) | 22 ± 3 (19–25) | – |
Diam. at anus/cloaca | 35.3 ± 4.3 (30–40) | 19 ± 1 (18–20) | – |
Diam. at vulva | 46.4 ± 5.8 (40–55) | – | – |
Vulva-anterior body distance | 791 ± 16 (770–809) | – | – |
Vulva-tail terminus distance | 124.5 ± 7.8 (115–136) | – | – |
Spermatheca-vulva distance | 82.2 ± 10.1 (72–96) | – | – |
Lip diam. | 21.3 ± 2.2 (19–24) | 10.7 ± 1.5 (9–12) | – |
Lip height | 7.5 ± 0.6 (7–8) | 6.2 ± 0.8 (6–7) | – |
First body annulus diam. | 23.8 ± 1.9 (20–26) | – | – |
Second body annulus diam. | 26.1 ± 2.7 (21–30) | – | – |
Pharynx length | 171.0 ± 4.7 (167–176) | – | – |
Annulus width | 4.1 ± 0.5 (3.6–5.1) | 1.9 ± 0.1 (1.8–2.0) | – |
Tail length | 88.0 ± 6.5 (79–94) | 98.7 ± 6.1 (92–104) | – |
V-anus distance | 42.0 ± 19.7 (28–71) | – | – |
R | 230.0 ± 9.2 (224–237) | – | 259–286 |
RSt | 21.0 ± 0.9 (18–23) | – | – |
Rph | 38.0 ± 0.2 (38–39) | – | – |
Rex | 41.4 ± 1.4 (39–43) | – | 48–52 |
RV(ant) | 187.0 ± 3.5 (185–190) | – | 207–226 |
RV | 46.0 ± 4.9 (37–54) | – | – |
RVan | 16.0 ± 8.5 (10–22) | – | 11–17 |
Ran | 27.0 ± 2.8 (25–29) | – | 35–41 |
VL/VB | 2.7 ± 0.3 (2.2–3.4) | – | 4.0–5.3 |
Spermatheca length | 22.7 ± 5.9 (12–30) | – | – |
Spermatheca diam. | 31.8 ± 8.1 (15–39) | – | – |
Spicules length | – | 54.3 ± 2.1 (52–56) | – |
Gubernaculum length | – | 20.3 ± 0.6 (20–21) | – |
Bursa length | – | 41.7 ± 6.4 (37–49) | – |
Body straight or ventrally arcuate. Cuticular sheath fitting closely to loosely to body. Lateral fields with two distinct longitudinal lines forming a band, with irregularities and breaks of striae or with anastomosis, an additional central line appears due to four ellipsoid markings on each annulus forming four blocks. Annuli outside lateral field with scratches. Labial region broad, anterior margins rounded, with two distinct annuli and elevated labial disc. Stylet long and slender, knobs posteriorly directed. Pharynx typical of the genus. Nerve ring encircling isthmus. Excretory pore, four annuli posterior and opposite to pharynx base. Reproductive system monodelphic-prodelphic, outstretched, spermatheca rounded to ovate, filled with spheroid sperm cells, vulval lips modified, vulval sleeve absent. Tail conical, symmetrically narrowing at distal region, tip rounded.
Cuticle annulation fine at midbody. Lateral fields marked by three longitudinal lines. Labial region distinctly trapezoid. Stylet and pharynx degenerated. Spicules semi-circular, tip slightly recurved. Gubernaculum linear, slightly thickened proximally. Bursa with crenate margin. Tail elongate, uniformly narrowing, annuli at distal end irregular.
This population was recovered from the rhizospheric soil of pomegranate (
Two 673 and 682 nt long D2-D3 expansion segments of LSU (MT901580, MT901581), one from each female specimen, were generated for the new species. A BLAST search using these sequences revealed they have 99.34% identity with
Two 904 and 907 nt long sequences of ITS rDNA (MT901582, MT901583) were generated for the new species. A single 683 nt long ITS rDNA sequence (MT901584) was obtained for the Iranian population of
A total of 70 sequences of
The objectives of this study were to characterize one new and one known species of the genus
In both inferred LSU and ITS phylogenies,
The newly described species in present study appeared similar to
The new species was isolated from the rhizosphere of date palm tree, that is a major food source for local populations in the Middle East, and plays important roles in their culture and economy (Chao and Krueger, 2007). Additional study is required to clarify if the parasitism of high nematode populations of