Uneingeschränkter Zugang

Antimicrobial Resistance Mechanisms in Carbapenem-Resistant Pseudomonas aeruginosa Clinical Strains Isolated in Shanghai, China

KEYING ZHU

KEYING ZHU

  • School of Laboratory Medicine and Biotechnology, Southern Medical UniversityGuangzhou, China
  • Department of Laboratory Medicine, Shanghai Fengxian District Central HospitalShanghai, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
ZHU, KEYING
, 
SUTING LI

SUTING LI

Department of Laboratory Medicine, Shanghai Fengxian District Central Hospital, Anhui University of Science and TechnologyShanghai, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
LI, SUTING
, 
ZIYAN GUO

ZIYAN GUO

Department of Laboratory Medicine, Shanghai Fengxian District Central Hospital, Anhui University of Science and TechnologyShanghai, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
GUO, ZIYAN
, 
CHENGCHAO XIAO

CHENGCHAO XIAO

Department of Laboratory Medicine, Shanghai Fengxian District Central HospitalShanghai, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
XIAO, CHENGCHAO
 und 
QUHAO WEI

QUHAO WEI

  • School of Laboratory Medicine and Biotechnology, Southern Medical UniversityGuangzhou, China
  • Department of Laboratory Medicine, Shanghai Fengxian District Central HospitalShanghai, China
  • Department of Laboratory Medicine, Shanghai Fengxian District Central Hospital, Anhui University of Science and TechnologyShanghai, China
Orcid-Profil
Suche nach diesem Autor auf
Sciendo|Google Scholar
WEI, QUHAO
  
31. Aug. 2025
Antimicrobial Resistance Mechanisms in Carbapenem-Resistant Pseudomonas aeruginosa Clinical Strains Isolated in Shanghai, China's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
COVER HERUNTERLADEN
Artikel-Kategorie: Original Paper
Online veröffentlicht: 31. Aug. 2025
Eingereicht: 03. Jan. 2025
Akzeptiert: 29. Mai 2025
DOI: https://doi.org/10.33073/pjm-2025-022
Schlüsselwörter
© 2025 KEYING ZHU et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Distribution of sequence types and antimicrobial resistance genes. In the phylogenetic tree, each branch is labeled with numerical values representing its length, which directly reflects the genetic distance. The 40 CRPAs can be divided into two major evolutionary branches in the upper and lower parts. Heat map of the antimicrobial resistance genes of 40 CRPAs showed the prevalence of resistance genes in different isolates, green represent the presence of the resistance gene, and blue represent its absense.
Distribution of sequence types and antimicrobial resistance genes. In the phylogenetic tree, each branch is labeled with numerical values representing its length, which directly reflects the genetic distance. The 40 CRPAs can be divided into two major evolutionary branches in the upper and lower parts. Heat map of the antimicrobial resistance genes of 40 CRPAs showed the prevalence of resistance genes in different isolates, green represent the presence of the resistance gene, and blue represent its absense.

Fig. 2.

Schematic structures of the different class 1 integrons. Solid black arrows represent variable region promoters; ovals represent attC sites of gene cassettes; hollow arrows represent intI1 gene, insertion sequence and resistant genes.
Schematic structures of the different class 1 integrons. Solid black arrows represent variable region promoters; ovals represent attC sites of gene cassettes; hollow arrows represent intI1 gene, insertion sequence and resistant genes.

Fig. 3.

Diagram of biofilm production capacity of CRPAs. Cutoff value (ODc) was calculated based on the negative control. ODc = average OD of negative control + (3 × SD of negative control). None: OD < ODc; Weak: ODc < OD < 2 × ODc; Moderate: 2 × ODc < OD < 4 × ODc; Strong: OD ≥ 4 × ODc.
Diagram of biofilm production capacity of CRPAs. Cutoff value (ODc) was calculated based on the negative control. ODc = average OD of negative control + (3 × SD of negative control). None: OD < ODc; Weak: ODc < OD < 2 × ODc; Moderate: 2 × ODc < OD < 4 × ODc; Strong: OD ≥ 4 × ODc.

Resistance rates of CRPA and C SPA isolates to commonly used antibiotics_

Antibiotics CRPA (n = 40) CSPA (n = 222) p
No. Rate (%) No. Rate (%)
TCC 29 72.50 37 16.67 < 0.001*
TZP 28 70.00 33 14.86 < 0.001*
MEM 29 72.50 0 0.00 < 0.001*
IMP 40 100.00 0 0.00 < 0.001*
FEP 10 25.00 4 1.80 < 0.001*
CSL 25 62.50 20 9.01 < 0.001*
CAZ 11 27.50 16 7.21 < 0.001*
ATM 11 27.5 24 10.81 0.004*
TOB 14 35.00 5 2.25 < 0.001*
AMK 3 7.5 1 0.45 0.012*
CIP 24 60 16 7.21 < 0.001*
LVX 29 72.50 37 16.67 < 0.001*
COL 5 12.50 1 0.45 < 0.001*

Mutations of porin OprD in 15 carbapenem-sensitive Pseudomonas aeruginosa isolates_

Isolate MLST Amino acid changes in OprD sequence Indels/gain of stop codon
CSPA31 ST244 None insertion of 1 bp at nt1206
CSPA261 ST244 None None
CSPA33, CSPA56, CSPA142, CSPA200, CSPA221, CSPA254, CSPA259 ST491, ST2060, ST992, ST849, ST3360, ST796, ST16 S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G, V359L Insertion of 30bp at nt1114
CSPA84 ST849 S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G Insertion of 81bp at nt1019
CSPA159 ST871 T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315G, G425A None
CSPA170 ST1337 None None
CSPA218, CSPA223 ST277, ST261 T103S, K115T, F170L None
CSPA252 ST4931 S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G, V359L Insertion of 30bp at nt1114

Mutations of porin OprD in 40 carbapenem-resistant Pseudomonas aeruginosa isolates_

Isolate Amino acid changes in OprD sequencea Indels/gain of stop codona
RPA22 ST207 S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347M insertion of 30bp at nt1114
RPA34 ST1632 D43N, S57E, S59R, E202Q deletion of 1bp at nt630
RPA35, RPA42 ST207 S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A premature codon stops at AA277
RPA48 ST277 T103S, K115T, F170L insertion of 7bp at nt557
RPA59, RPA130, RPA139 ST277 T103S, K115T deletion of 1bp at nt354
RPA53, RPA58, RPA90, RPA154, RPA174, RPA204, RPA227, RPA233, RPA237, RPA253 ST270 V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T insertion of 2bp at nt729
RPA67 ST245 T103S, K115T deletion of 32bp at nt426
RPA101, RPA239 ST3874 D43N, S57E, S59R insertion of 1bp at nt174
RPA123 ST234 V127L, E185R deletion of 1bp at nt558
RPA125 ST871 T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315G insertion of 1bp at nt1206
RPA140 ST357 S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, 276A, A281G, K296Q, Q301E, R310E, A315G, L347M insertion of 30bp at nt1114
RPA143 ST871 None premature codon stops at AA6
RPA150 ST1021 T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315G insertion of 55bp at 1089nt
RPA161 ST773 T103S, K115T, V129I deletion of 1bp at nt460
RPA153 ST235 None deletion of 11bp at nt55
RPA167, RPA208, RPA209, RPA211, RPA251 ST235 T103S, K115T, F170L, E185Q, P186G, V189T premature codon stops at AA277
RPA182 ST773 T103S, K115T, V129I deletion of 10bp at nt463
RPA186 ST242 D43N, S57E, S59R insertion of 2bp at nt383
RPA224 ST313 S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347M insertion of 30bp at nt1114
RPA225 ST4 D43N, S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S insertion of 1bp at nt821
RPA247 ST316 S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347M insertion of 30bp at nt1114
RPA232 ST676 D43N, S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G, V359L, insertion of 30bp at nt1114
RPA256 T1182 S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347M insertion of 30bp at nt1114

Resistance rates of mexY overexpressed CRPAs and none-overexpressed mexY CRPAs_

Antibiotics Overexpression of mexY (n = 23) None-overexpression of mexY (n = 17) p
Number Rate (%) Number Rate (%)
Penicillin/β-lactamase inhibitor combinations 21 91.30 10 58.82 0.006*
Meropenem 21 91.30 8 47.06 0.001*
Cephalosporins 21 91.30 5 29.41 < 0.001*
Monocyclic β-lactams 6 26.09 5 29.41 1.000
Aminoglycosides 13 56.52 2 11.76 0.002*
Fluoroquinolones 21 91.30 8 47.06 0.001*

Primers used for reverse transcription-quantitative PCR_

Target gene Primers Sequence (5′ to 3′)
mexB mexB-F CAACATCCAGGACCCACTCT
mexB-R AGGAAATCTGCACGTTCTGC
mexD mexD-F CTACCCTGGTGAAACAGC
mexD-R AGCAGGTACATCACCATCA
mexF mexF-F TGTACGCGAACGACTTCAAC
mexF-R GAGGTGTCGCTGACCTTGAT
mexY mexY-F TCAGGCCGACCTTGAAGTAG
mexY-R TCTCGGTGTTGATCGTGTTC
rpsL rpsL-F TACTTCGAACGACCCTGCTT
rpsL-R TTTCCTCGTACATCGGTGGT

Resistance rates of mexB overexpressed CRPAs and none-overexpressed mexB CRPAs_

Antibiotics Overexpression of mexB (n = 5) None-overexpression of mexB (n = 35) p
Number Rate (%) Number Rate (%)
Penicillin/β-lactamase inhibitor combinations 5 100 25 71.43 0.306
Meropenem 5 100 24 68.57 0.298
Cephalosporins 3 60.00 23 65.71 1.000
Monocyclic β-lactams 4 80.00 7 20.00 0.015*
Aminoglycosides 0 0 15 42.86 0.137
Fluoroquinolones 5 100 25 71.43 0.306
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Mikrobiologie und Virologie
Zeitschrift RSS Feed