Stalactites Core Prospect as Environmental “Microbial Ark”: The Actinomycetota Diversity Paradigm, First Reported from a Greek Cave

Research site. The sample site was Agios Athanasios cave. The cave is sited in central Greece, region of Thessaly (39°28’43.9’N, 22°52’53.9’E, 400 m above sea level, Fig. 1) and formed about a 200 m long horizontal labyrinth of passages. The cave is between 20- and 30-meters underground, and there no light is present. Water from Karla’s Lake covers the area around the cave, and the dominating tree species on the peninsula is Quercus coccifera. Archaeologists have discovered evidence that the cave was utilized during the Mycenaean and Neolithic eras. It is regarded as one of the most historically prominent caves of Magnesia and Thessaly in general due to the findings unearthed there and its size.

Fig. 1.

Stalactite collection. For this investigation, we handled symmetrically sized, 7.5–8 cm diameter subsamples from a stalactite taken with sterile gloves and stored in sterile plastic containers. Inside Agios Athanasios cave, the stalactite sample was acquired in 2021 within a depth of more than 50 meters (Fig. 2). As presented by Durazzi et al. (2021), there are no statistically significant differences depicted among phyla, families, and genera, so in the present work, we firstly reported taxonomic results acquired by metataxonomics (16S rRNA gene sequencing) from a stalactite core sample. Noteworthy is that strict regulations, which Greek National Environmental and Archeological Authorities apply for all subterranean areas, restricted us from acquiring more stalactites as core samples. Nevertheless, the material was adequate to double-check our methodological approach and validate aliquots as tetra-plicate iterations.

Fig. 2.

DNA extraction and DNA sequence analysis. Following the manufacturer’s recommendations, a Nucleo-Spin Soil DNA isolation kit (Macherey-Nagel, Germany) was used to extract the entire metataxonomic DNA from our stalactite sample rapidly. The same core sample in aliquots was replicated four times, according to Michail et al. (2021); however, DNA was extracted using different settings. The Quawell UV-Vis Spectrophotometer (Quawell Ltd., EU) was used to assess the DNA’s quality and concentration (Q5000). Before the libraries were prepared, the DNA samples were kept at 20°C.

Samples taken from the stalactite core were sequenced at the Institute for Applied Biosciences, Thessaloniki, Greece. Illumina’s 16S rRNA metataxonomics protocol (part number 15044223 rev. B; Illumina, Inc., USA) was used to amplify the V3 and V4 regions of the bacterial 16S rRNA gene utilizing the following primers containing Illumina overhang adaptors. Universal forward and reverse primer sequences used were those described by Klindworth et al. (2013), 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGA CAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTC GTGGGCTCGGAGATGTGTATAAGAGACAGGAC TACHVGGG-TATCTAATCC-3’, respectively, yielding an amplicon of approximately 460 bp. 2x Kapa HiFi Hot-Start ReadyMix (Roche, Switzerland) was used for PCR amplification, and PCR products were purified with Beckman Coulter Agecourt AMPure XP Beads (Beckman Coulter, USA) according to the protocol.

Illumina indexes and sequencing adapters were attached using the Nextera^® XT Index Kit (Illumina, USA), followed by secondary purification using Beckman Coulter Agecourt AMPure XP Beads. Library quantification was performed using a Qubit^™ 3.0 fluorometer (Life Technology Ltd., UK). Additionally, 2 μl of the final library was run on the Fragment Analyzer using the DNF-473-33-SS NGS Fragment 1–6,000 bp method to confirm library quality and size. After library quantification, normalization, and pooling, the concentration was adjusted to 125 pM and prepared for loading onto the Illumina MiSeq following Illumina’s 16S rRNA metataxonomics protocol (part number 15044223 rev. B; Illumina, Inc., USA). Library pools were denatured and loaded onto the Illumina MiSeq at 12.5 pM, and paired-ends (2,300) were sequenced using the MiSeq Reagent Kit v3 (600 cycles) (Illumina, Inc., USA).

Moreover, one more significant issue that should be given attention to is that inside the stalactite core, the abundance of the bacteria entrapped is scarce, with a lower number of reads (less than 500,000) in contrast to other biological samples (i.e., alimentary tract with up to 2¹⁹ reads). Clearly, for this situation, the utilization of metataxonomics (16S rRNA) is ideal and functions in much more the same way, or even as far superior to other metagenomics (i.e., entire shotgun metagenomic sequencing) (Klindworth et al. 2013; Michail et al. 2021).

Bioinformatics and statistical analysis. The raw sequence data were processed using the Mothur pipeline (Schloss et al. 2009) and performed standard operating procedures (SOPs) for MiSeq data developed by the creators of Schloss Lab, a Mothur software package within Galaxy (Kozich et al. 2013; Afgan et al. 2018).

Firstly, we organized the 300 bp paired-end reads into paired collections and combined the forward and reverse reads for each sample into a single FASTA file. We then performed quality control and data cleaning to remove ambiguous bases and sequences over 460 bp. The files for computation are optimized to remove duplicate sequences. Thirdly, the sequence reads were compared to the Silva database reference alignment (silva.seed_v138_1.align) using Needleman alignment and k-mer search methods.

Further denoising of the sequences was performed by pre-grouping and sorting them by frequency. Finally, sequences artifacts known as chimeras and non-bacterial sequences such as archaeal, eukaryotic, and unknown were removed. Operational taxonomic units (OTUs) were identified at a DNA similarity level of 97% and an order control level. A total of 5,516 OTUs associated with bacteria were considered.

All of the above datasets are available as supplementary material such as order Micrococcales (Fig. S1–S6); order Propionibacteriales (Fig. S7–S11); order Pseudonocardiales (Fig. S12); order Mycobacteriales (Fig. S13–S16); order Rubrobacterales (Fig. S17); order Geodermatophilales (Fig. S18 and S19); order Micromonosporales (Fig. S20–S22); order Jiangellales (Fig. S23 and S24); order Streptosporangiales (Fig. S25 and S27); order Sporichthyales (Fig. S28); order Kineosporiales (Fig. S29); order Bifidobacteriales (Fig. S30); order Acidothermales (Fig. S31); order Gaiellales (Fig. S32); order Solirubrobacterales (Fig. S33–S36); order Acidimicrobiales (Fig. S37 and S38).

Pseudarthrobacter (7,880 reads of bacteria or 80% of Micrococcaceae (family), 61% of Micrococcales (order), 11% Actinobacteria (phylum), and 2% of total Bacteria), (Fig. S1). A study on the isolation and characterization of Pseudarthrobacter species from Antarctic soil has shown that they are crucial for our understanding of Antarctic soil-related bacterial communities and for developing commercially beneficial cold-active enzymes (Shin et al. 2020).

Kocuria (479 reads of bacteria or 5% of Micrococcaceae (family), 4% of Micrococcales (order), 0.7% Actinobacteria (phylum) and 0.1% of total Bacteria), (Fig. S2). Kocuria species are skin and oropharynx rare bacterium in mammals (including man), and environmental organisms inhabiting the soil and several other ecological niches. Studies on species of the Kocuria genus showed that they were mainly located in Asia, and from Egyptian desert to Antarctica and to Siberian Sea (Savini et al. 2010).

Paeniglutamicibacter (3 reads of bacteria or 0.03% of Micrococcaceae (family), 0.02% of Micrococcales (order), 0.004% Actinobacteria (phylum), and 0.0009% of total Bacteria) (Fig. S3). Studies on Paeniglutamicibacter species demonstrated that they were frequently reported from Antarctic and alpine environments (Sakdapetsiri et al. 2019).

Oryzihumus (1,299 reads of bacteria or 70% of Intrasporangiaceae (family), 10% of Micrococcales (order), 2% of Actinobacteria (phylum), and 0.4% of total Bacteria) (Fig. S4). All species of Oryzihumus genus were primarily isolated in Asia (Kim et al. 2017).

Cellulomonas (458 reads of bacteria or 100% of Cellulomonadaceae (family), 4% of Micrococcales (order), 0.7% Actinobacteria (phylum) and 0.1% of total Bacteria) (Fig. S5). Cellulomonas species are mostly isolated from environmental samples (e.g., stored paddy rice, soil, air, seawater, and decayed tree), some from human clinical samples, rarely from wild animals, and the vast majority of environmental isolations of Cellulomonas spp. derive from Asia (Han et al. 2022).

Brachybacterium (65 reads of bacteria or 100% of Dermabacteraceae (family), 0.5% of Micrococcales (order), 0.09% Actinobacteria (phylum) and 0.02% of total Bacteria), (Fig. S6). Habitats range of Brachybacterium spp. are remarkably broader, ranging from sediment, soil, and poultry waste to steep corn liquor, medieval paints, and the rhizosphere (Stackebrandt 2014).

Microlunatus (2,665 reads of bacteria or 83% of Propionibacteriaceae (family), 36% of Propionibacteriales (order), 4% of Actinobacteria (phylum) and 0.8% of Bacteria), (Fig. S7). And in this occasion, the majority of species of the Microlunatus genus were isolated in Asia (Xie et al. 2020).

Cutibacterium (551 reads of bacteria or 17% of Propionibacteriaceae (family), 7% of Propionibacteriales (order), 0.8% of Actinobacteria (phylum) and 0.2% of Bacteria), (Fig. S8). Species of that genus exist in different environments reflecting their uniqueness in their genetic makeup. The pathogenicity of these species includes inflamed acne, progressive macular hypomelanosis (PMH), infections in the heart, bone, breast, and lumbar discs, prostate cancer, liver abscesses, and sarcoidosis (Dekio et al. 2021).

Nocardioides (1,276 reads of bacteria or 49% of Nocardioidaceae (family), 17% of Propionibacteriales (order), 2% of Actinobacteria (phylum) and 0.4% of total Bacteria), (Fig. S9). The genus contains species with strains isolated from different environmental niches (Roh et al. 2020).

Marmoricola (1,269 reads of bacteria or 48% of Nocardioidaceae (family), 17% of Propionibacteriales (order), 2% of Actinobacteria (phylum), and 0.4% of total Bacteria), (Fig. S10). Species of the genus were isolated from various environments such as marble, marine sediment, soil, volcanic ash, marine sponge, and mangrove plant (Habib et al. 2020).

Aeromicrobium (21 reads of bacteria or 0.8% of Nocardioidaceae (family), 0.3% of Propionibacteriales (order), 0.03% of Actinobacteria (phylum), and 0.006% of total Bacteria), (Fig. S11). Species of the genus were isolated from various environments (Siddiqi et al. 2018).

Pseudonocardia (1,492 reads of bacteria or 78% of Pseudonocardiaceae (family), 78% of Pseudonocardiales (order), 2% of Actinobacteria (phylum), and 0.46% of total Bacteria), (Fig. S12). They were discovered from different environmental samples, including soil, marine sediments, activated sludge, termite nests, gold mine core, and plant tissues (Parte et al. 2020).

Rhodococcus (517 reads of bacteria or 94% of Nocardiaceae (family), 38% of Mycobacteriales (order), 0.8% of Actinobacteria (phylum) and 0.1% of total Bacteria), (Fig. S13). Studies on members of the genus Rhodococcus demonstrated that they were isolated from different habitats, including soil, bug, wastewater, bat-dried guano of a cave, marine coral reef, from the coldest, desiccating, and oligotrophic permafrost soils of the high-elevation McMurdo Dry Valleys in Antarctica, and from Comau fjord of a pristine Marine Protected Area in the Chilean Patagonia (Undabarrena et al. 2018).

Corynebacterium (312 reads of bacteria or 100% of Corynebacteriaceae (family), 23% of Mycobacteriales (order), 0.5% of Actinobacteria (phylum) and 0.09% of total Bacteria), (Fig. S14). They are widespread and can be isolated from the skin and the upper respiratory and gastrointestinal tracts. The strains of medical and veterinary interest are generally divided into two subgroups: diphtheria and non-diphtheria (Araújo et al. 2018).

Smaragdicoccus (27 reads of bacteria or 5% of Nocardiaceae (family), 2% of Mycobacteriales (order), 0.04% of Actinobacteria (phylum) and 0.008% of total Bacteria), (Fig. S15). A study on Smaragdicoccus niigatensis has shown that it is the only species member of the Smaragdicoccus genus isolated from petroleum-contaminated soil, obtained from a spurt of petroleum at Nishiyama-cho in Niigata, Japan (Adachi et al. 2007).

Mycobacterium (382 reads of bacteria or 100% of Mycobacteriaceae (family), 28% of Mycobacteriales (order), 0.58% of Actinobacteria (phylum) and 0.11% of total Bacteria), (Fig. S16). Studies on several significant human and animal pathogens including members of the M. tuberculosis complex and Mycobacterium avium subspecies paratuberculosis, the etiological agent of Johne’s disease, a contagious disease listed by the World Organization for Animal Health can be enumerated (Brites et al. 2018).

Rubrobacter (148 reads of bacteria or 100% of Rubrobacteraceae (family), 0.2% of Actinobacteria (phylum), and 0.04% of total Bacteria), (Fig. S17). Many studies on Rubrobacter species reveled that they were isolated from marine environments; thus, the ocean is a unique habitat for Rubrobacter organisms (Chen et al. 2020).

Blastococcus (591 reads of bacteria or 63% of Geodermatophilaceae (family), 0.9% of Actinobacteria (phylum), and 0.2% of total Bacteria), (Fig. S18). At the time of writing this manuscript, species were isolated from the Baltic Sea, from a Roman archaeological pool located in Tunisia, sand sediment of a beach in Jeju, Korea, an extreme hyper-arid soil sample from the Atacama Desert, sea-tidal sediment sampled at Republic of Korea, from sand samples collected from Gurbantunggut desert located in China (Yang et al. 2019).

Modestobacter (272 reads of bacteria or 29% of Geodermatophilaceae (family), 0.4% of Actinobacteria (phylum), and 0.08% of total Bacteria), (Fig. S19). Studies on members of this genus showed that they were recovered from diverse habitats,. They are associated with extreme biomes, and Modestobacter strains are a common feature of the Atacama Desert biome and they adapted to harsh environmental conditions (Bull et al. 2017).

Allocatelliglobosispora (168 reads of bacteria or 30% of Micromonosporaceae (family), 0.2% of Actinobacteria (phylum), and 0.05% of total Bacteria), (Fig. S20). A study on Allocatelliglobosispora, a genus of bacteria from the family of Micromonosporaceae, with one known species, the Allocatelliglobosispora scoriae demonstrated that it was isolated from volcanic ash collected near Darangshi Oreum (a parasitic volcano or satellite cone) in Jeju, Republic of Korea (Lee and Lee 2011).

Plantactinospora (23 reads of bacteria or 4% of Micromonosporaceae (family), 0.03% of Actinobacteria (phylum) and 0.007% of total Bacteria), (Fig. S21). Currently, seven species of the genus Plantactinospora have been described and they were isolated from plants in China (Li et al. 2018).

Catellatospora (7 reads of bacteria or 1% of Micromonosporaceae (family), 0.01% of Actinobacteria (phylum) and 0.002% of total Bacteria), (Fig. S22). A study on Plantactinospora species revealed that they were first isolated from soil and volcanic sediment samples in Asia (Liu et al. 2020).

Jiangella (222 reads of bacteria or 79% of Jiangellaceae (family), 0.03% of Actinobacteria (phylum), and 0.06% of total Bacteria), (Fig. S23). Despite a ange of different habitats from which species of the genus Jiangella can be isolated, a study has shown that arid and desert habitats attract special attention (Saygin et al. 2020).

Haloactinopolyspora (3 reads of bacteria or 1% of Jiangellaceae (family), 0.004% of Actinobacteria (phylum), and 0.0009% of total Bacteria), (Fig. S24). At the time of writing, the genus Haloactinopolyspora comprises only two species isolated from soil samples collected from northwest China (Zhang et al. 2014).

Actinocorallia (151 reads of bacteria or 63% of Thermomonosporaceae (family), 0.2% of Actinobacteria (phylum), and 0.04% of total Bacteria), (Fig. S25). The genus comprises nine species, some isolated from soil samples, a natural cave, and from plant roots in southwest China (Li et al. 2018).

Actinomadura (62 reads of bacteria or 27% of Thermomonosporaceae (family), 0.09% of Actinobacteria (phylum), and 0.02% of total Bacteria), (Fig. S26). Studies on Actinomadura strains have shown that are primarily distributed in terrestrial soils, in plant tissues, and marine sources (Abagana et al. 2016).

Streptomyces (156 reads of bacteria or 75% of Streptomycetaceae (family), 0.2% of Actinobacteria (phylum) and 0.04% of total Bacteria), (Fig. S27). In recent years, much of the attention has been focused on more extreme environment habitats such as deep-sea, desert, cryo, and volcanic environments for the isolation of potential Streptomyces species and the discovery of important bioactive secondary metabolites including antibiotics, immunosuppressive drugs, anticancer drugs, and other biologically active compounds (Abdelkader et al. 2018).

Sporichthya (80 reads of bacteria or 100% of Sporichthyaceae (family), 0.1% of Actinobacteria (phylum) and 0.02% of total Bacteria), (Fig. S28). A study on these species demonstrated that they were isolated from greenhouse soil in the USA, and soil samples in Japan (Tamura et al. 1999).

Thalassiella (50 reads of bacteria or 100% of Kineosporiaceae (family), 0.07% of Actinobacteria (phylum), and 0.01% of total Bacteria), (Fig. S29). A study on Thalassiella azotovora, the only family member Kineosporiaceae, described that it was collected from a seawater sample from Sadong Wharf, Ulleung-Island, South Korea (Lee et al. 2016).

Bifidobacterium (15 reads of bacteria or 100% of Bifidobacteriaceae (family), 0.02% of Actinobacteria (phylum), and 0.004% of total Bacteria), (Fig. S30). Interestingly, most of the most recently discovered Bifidobacteria species have been isolated from mammals (Lugli et al. 2021).

Acidothermus (1 read of bacteria or 100% of Acidothermaceae (family), 0.001% of Actinobacteria (phylum), and 0.0003% of total Bacteria), (Fig. S31). A study on Acidothermus cellulolyticus has presented that it is the only genus of the Acidothermaceae family, isolated from acidic hot springs in Wyoming, USA (temperatures of 45 to 65°C and a pH range of 4 to 5.5) (Sen et al. 2014).

Gaiella (17,605 reads of bacteria or 100% of Gaiellaceae (family), 79% Thermoleophilia, and 5% of total Bacteria), (Fig. S32). At the time of writing, only one genus and one species, strain Gaiella occulta F2-233T isolated from a deep mineral water aquifer in Portugal at a temperature of 28.0°C with a pH of 5.9, is validly published in the family Gaiellaceae of the order Gaiellales (Albuquerque et al. 2011).

Conexibacter (1 read of bacteria or 100% of Conexibacteraceae (family), 0.03% Solirubrobacterales (order) and 0.0003% of total Bacteria), (Fig. S33). A study on the species of the genus demonstrated that they were isolated from soil and lava cave stalactite samples (Lee 2017).

Paraconexibacter (1 read of bacteria or 100% of Paraconexibacteraceae (family), 0.03% Solirubrobacterales (order), and 0.0003% of total Bacteria), (Fig. S34). A study on the Paraconexibacteraceae family, with one validly published species, the Paraconexibacter algicola, showed that it was isolated from a eutrophic lake during the end of cyanobacterial harmful algal blooms from the surface water (0–10 cm depth) sampled at Lake Seo, Republic of Korea, (Chun et al. 2020).

Patulibacter (29 reads of bacteria or 100% of Patulibacteraceae (family), 1% Solirubrobacterales (order), and 0.0008% of total Bacteria), (Fig. S35). A study on these species revealed that they were isolated from rhizosphere samples (Jin et al. 2016).

Solirubrobacter (6 reads of bacteria or 100% of Solirubrobacteraceae (family), 0.2% Solirubrobacterales (order), and 0.0002% of total Bacteria), (Fig. S36). They were isolated from soil and plant samples (Zhang et al. 2014).

Actinomarinicola (784 reads of bacteria or 100 of Lamiaceae (Family), 6.5% of Acidimicrobiales (order), and 0.21% of total Bacteria), (Fig. S37). The Actinomarinicola genus comprises from a single species, the Actinomarinicola tropica and it was isolated from a sediment sample collected from the South China Sea (depth of 460 m) (He et al. 2020).

Desertimonas (182 reads of bacteria or 2% of Acidimicrobiales (order), and 0.05% of total Bacteria), (Fig. S38). The genus Desertimonas consists of one species, the Desertimonas flava and it was isolated from a soil sample of Gurbantunggut desert, China (Asem et al. 2018).