Nutrients Changed the Assembly Processes of Profuse and Rare Microbial Communities in Coals
Artikel-Kategorie: Original Paper
Online veröffentlicht: 24. Sept. 2022
Seitenbereich: 359 - 370
Eingereicht: 18. Apr. 2022
Akzeptiert: 09. Juli 2022
DOI: https://doi.org/10.33073/pjm-2022-032
Schlüsselwörter
© 2022 Yuanyuan Zhang et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Coal is the most vital fossil fuel on earth (Sekhohola et al. 2013; Iram et al. 2017), the value of which is far greater than that of petroleum and natural gas. The formation of coal is driven by geological events (Emery et al. 2020), geologic settings (Li et al. 2018), and microorganisms (Liu et al. 2019). Microbes are the dominant form of life in subsurface ecosystems, including coals, and play vital roles in biogeochemical cycles such as the carbon cycle (Iram et al. 2017). In addition, the synergistic interaction of microbial complexes in coal seams drives the production of a large proportion (20–40%) of global methane reserves (Thielemann et al. 2004; Faiz and Hendry 2006; Rathi et al. 2019). Therefore, the development of biogenic coalbed methane has gradually attracted more attention, and scholars expect to stimulate the production potential of biogenic methane in coalbeds through various methods, particularly nutrient addition, to improve coalbed methane (CBM) production (Jones et al. 2010; in ’t Zandt et al. 2018).
Researchers have mainly focused on the abundance and activity of methanogenic archaea in addition to microbial diversity under nutrient stimulation (in ’t Zandt et al. 2018; Wang et al. 2019b; Bucha et al. 2020; Pytlak et al. 2020). These methanogenic groups are the drivers of the final step in degrading organic matter into methane in coal seams (Vick et al. 2019). However, little attention has been given to the process of microbial assembly (including profuse and rare taxa) under nutrient stimulation. This knowledge is of great importance for understanding the microbial ecology of coal seams and judging the sustainability of methane production stimulated by nutrients.
Generally, the dominant taxa in microbial community changes have received more attention (Wu et al. 2017). However, microbial taxa with low abundance are often identified as the “rare biosphere”; these taxa represent most of the biodiversity on Earth (Ji et al. 2020), undertake essential ecological functions (Ji et al. 2020), and play vital roles in community function and stability in ecosystems (Jousset et al. 2017). For example, the majority of turnover in community composition was observed in rare taxa in sandy soils (Gobet et al. 2012). These rare microbes also drive anaerobic respiration, such as sulfate reduction (Pester et al. 2010) and respiratory denitrification (Philippot et al. 2013) in anaerobic environments. Thus, understanding the assembly process for profuse and rare microbial taxa is vital for knowledge on microbe-driven biogenic methane production processes in coals.
It is generally believed that deterministic and stochastic processes co-occur and control the aggregation of microbial communities (Chase 2010; Chase and Myers 2011). Traditional niche theory assumes the dominant role of deterministic processes and holds that deterministic factors, including species characteristics, interspecific interactions, and environmental conditions, determine community structure (Chesson 2000; Fargione et al. 2003). In contrast, neutral theory considers that stochastic processes control the aggregation of microbial communities, including birth, death, colonization, extinction, and speciation, which are independent of species characteristics (Chesson 2000; Fargione et al. 2003). The importance of stochastic processes in controlling microbial diversity has received little attention until recently (Zhou et al. 2014; Stegen et al. 2015). Many studies have found that changes in microbial communities can be driven by stochastic processes such as historical contingency, ecological drift, and dispersal limitations (Chase 2010; Ofiţeru et al. 2010; Zhou et al. 2014; Evans et al. 2017). However, our knowledge of microbial assembly processes in underground environments, particularly in coals and profuse and rare microbial communities in coals under nutrient stimulation. It limits our understanding of the mechanistic responses of coal microbial diversity and community composition to nutrient stimulation.
This study extracted 16S rRNA data on coal sample microbial composition under different treatments from the NCBI database and reanalyzed the assembly process of profuse and rare taxa under nutrient stimulation. This knowledge is of great importance for understanding the microbial ecology of coals and the sustainability of methane production stimulated by nutrients.
Detailed sample information on 59 microbial communities in coals for meta-analysis.
ID/NCBI accession number | Sites | Primer sequences | Coal rank | Treatment | References |
---|---|---|---|---|---|
SRR9312778-SRR9312784 | Erlian Basin | 515F: GTGCCAGCMGCCGCGG |
Lignite | ck (no treat | (Wang et al. 2019a) |
SRR6998887 | Moghla | 515F: GTGCCAGCMGCCGCGGTAA |
Bituminous | (Sharma et al. 2019) | |
SRR1695964 | Queensland | 926F: AAACTYAAAKGAATTGACGG |
Bituminous | (Raudsepp et al. 2016) | |
SRR1695967 | |||||
SRR1695969 | |||||
SRR1695971 | |||||
SRR5342611 | Powder River Basin | 341F: CCTACGGGNBGCASCAG |
Bituminous | (Davis et al. 2018) | |
SRR8373697-SRR8373705 | Anhui | 338F: ACTCCTACGGGAGGCAGCAG |
Bituminous | (Liu et al. 2019) | |
SRR8373722-SRR8373724 | |||||
SRR8373719-SRR8373721 | Guizhou | Anthracite | |||
SRR8373696 | Shanxi | Bituminous | |||
SRR8373718 | |||||
SRR8373734-SRR8373745 | |||||
SRR8373746 | Anthracite | ||||
SRR8373747 | |||||
SRR7271165 | Huaibei Coalfield | 515F: GTGCCAGCMGCCGCGG |
Bituminous | nutrients | (Wang et al. 2019b) |
SRR11128868 | Konin Basin | 341F: CCTACGGGNGGCWGCAG |
Lignite | (Bucha et al. 2020) | |
SRR5826886 | New South Wales | Bituminous | (in 't Zandt et al. 2018) | ||
SRR5826888 | |||||
SRR5826889 | |||||
SRR11241403 | Upper Coal Basin Silesian | Bituminous | (Pytlak et al. 2020) | ||
SRR5397976 | Konin Basin | 314F: CCTACGGGNGGCWGCAG |
Bituminous | (Detman et al. 2018) | |
SRR7422168 | Jiaozuo | Anthracite | (Su et al. 2018) | ||
SRR7422169 | Neimeng | Bituminous | |||
SRR7422170 | Suzhou | Bituminous | |||
SRR7422171 | Jingcheng | Anthracite | |||
SRR7422172 | Hebi | Bituminous | |||
SRR7422173 | Shaqu | Bituminous | |||
SRR7422174 | Liyazhuang | Bituminous | |||
SRR7422175 | Yima | Bituminous | |||
SRR7422176 | Pingdingshan | Bituminous | |||
SRR7422177 | Shoushan | Bituminous | |||
SRR5342597 | Powder River Basin | 341F: CCTACGGGNBGCASCAG |
Bituminous | (Davis et al. 2018) | |
SRR5342605 | Bituminous |
Manhattan plots were used to analyze the enrichment of genera based on their taxonomy using the Tutools platform (
The Raup-Crick index (RCI) and the β nearest taxon index (βNTI) were calculated to determine the assembly processes for profuse and rare microbial taxa. A value of –2 < βNTI < 2 was interpreted as indicating that the turnover of a group of communities was primarily due to stochastic processes, and the turnover of communities was interpreted as governed primarily by probabilistic dispersal when |RCI| > 0.95 (homogenizing dispersal when RCI < –0.95 and dispersal limitation when RCI > 0.95). In addition, turnover between a pair of communities was mainly due to deterministic processes when |βNTI| > 2 (homogeneous selection when βNTI < –2 and variable selection when βNTI > 2). In addition, the communities were driven by undominated processes when |RCI| < 0.95, which mostly involved weak selection, weak dispersal, diversification, and/ or drift (Stegen et al. 2015).
Network analysis was used to explore the co-occurrence patterns of profuse and rare microbial taxa. Spearman’s correlations between the relative abundance of genera for profuse and rare microbial groups were considered for a Spearman’s correlation coefficient (ρ) > 0.55 and a
Fig. 1
a) Chao1 index and b) Shannon index of the abundant and rare genera in coals. The Wilcoxon test was used to compare the differences in microbial diversities.

Fig. 2
a) Ordering of the abundant community compositions at the genus level by nonmetric multidimensional scaling (NMDS) based on the Bray-Curtis dissimilarity index; b) ordering of the rare community compositions at the genus level by NMDS based on the Bray-Curtis distance index; c) difference for Bray-Curtis dissimilarities among nutrient and ck groups. The Wilcoxon test was used to compare the differences in Bray-Curtis dissimilarities.

Fig. 3
Manhattan plot of the changes in a) abundant and b) rare genera in coals under nutrient stimulation. Detailed information is shown in Tables SII and SIII.

Fig. 4
Heatmap for a) the profuse and b) rare known genera (detected in more than 30% of samples).

The redundancy analysis (RDA) showed that coal characteristics, including TC, TN, TO, TH, Vdaf, Ad, and Mad, strongly affect the compositions of profuse and rare microbes in coals without nutrients (Fig. 5a and 5b). In the coal samples with added nutrients, the factors affecting the compositions of profuse and rare microbes were reduced (Fig. 5c and 5d). TN and TO affected the composition of profuse microbes, and TC and TO affected the composition of rare microbes. In addition, the organic carbon (OC) and ammonium ion (NH4+) contents in the nutrients were important factors affecting the compositions of profuse and rare microbes at the phylum level (Fig. 5e and 5f). Herein, an increase in NH4+ may have an effect on the Euryarchaeota phylum in profuse and rare taxa, and an increase in OC could affect the Firmicutes phylum in profuse and rare taxa.
Fig. 5
Redundancy analysis (RDA) for coal characteristics (including TC, TN, TO, TH, Vdaf, Ad, and Mad) on the coal microbial compositions.
a) the effect of coal characteristics on profuse microbial compositions in the ck group; b) the effect of coal characteristics on rare microbial compositions in the ck group; c) the effect of coal characteristics on profuse microbial compositions in the nutrient group; d) the effect of coal characteristics on rare microbial compositions in the nutrient group; e) the effect of nutrients on profuse microbial compositions; f) the effect of nutrients on rare microbial compositions.

Fig. 6
Deterministic and stochastic processes in community assembly. a) βNTI index in abundant and rare groups; b) the relative influences of deterministic and stochastic assembly processes in shaping abundant and rare groups. Detailed information is shown in Tables SIV–SVII.

Fig. 7
Co-occurrence networks of abundant and rare groups in coals based on the correlation analysis. Detailed information is shown in Tables SVIII–SXI. Pro – Proteobacteria, Act – Actinobacteria, Bact – Bacteroidetes, Fir – Firmicutes, Ver – Verrucomicrobia, Pla – Planctomycetes, Spi – Spirochaetes, Acido – Acidobacteria, Eury – Euryarchaeota, Cren – Crenarchaeota, Gem – Gemmatimonadetes, Chl – Chloroflexi, and Syn – Synergistetes.

This study assessed the assembly processes of profuse and rare microbial communities in coals under nutrient (such as organic carbon, and nitrogen) stimulation. The analyzed taxonomic unit was used at the genus level to avoid OTU sequence differences caused by various amplified primers. In microbial research on coal seams, including these referenced studies, the most significant attention has been given to groups related to the formation of biogenic coalbed methane (Szafranek-Nakonieczna et al. 2018; Plyatsuk et al. 2020). These studies are critical hubs for applying microbial knowledge to practical production.
Coal seams are important habitats for the co-existence of underground microbial communities, and improving the activity of functional microorganisms also requires consideration of the relationships between multiple microbial groups. Coal seams possess many bacterial taxa, including Firmicutes, Spirochetes, Bacteroidetes, and Proteobacteria (Dawson et al. 2012; Chen et al. 2018). This study found that nutrients have a selective stimulating effect on profuse and rare groups. In addition, these investigated studies highlighted that nutrient addition can effectively accelerate CBM production and that biomethane production is closely related to coal decomposition (in ’t Zandt et al. 2018; Pytlak et al. 2020). Therefore, the focus of this study was to identify the core profuse and rare genera stimulated by nutrients, which have potential value in the study of biological CBM.
The main components of nutrients added in the surveyed studies were similar (Davis et al. 2018; Detman et al. 2018; in ’t Zandt et al. 2018; Su et al. 2018; Wang et al. 2019b; Bucha et al. 2020; Pytlak et al. 2020), mainly including organic carbon such as tryptone and yeast, ammonia salts, and potassium and sodium salts. The changes in profuse and rare taxa caused by adding nutrients are different for different coal ranks. Most studies also support the finding that the microbial community structure of coals differs among various ranks (Su et al. 2018; Liu et al. 2019). In this study, the shifts in the composition of profuse and rare microbial communities caused by nutrients mainly occurred in bituminous and anthracite coals. This result may have been overlooked in previous studies (Davis et al. 2018; Detman et al. 2018; in ’t Zandt et al. 2018; Su et al. 2018; Wang et al. 2019b; Bucha et al. 2020; Pytlak et al. 2020). In addition, the Chao1 richness for lignites was higher when nutrients were added to both profuse and rare genera. This may be related to the selective stimulation of nutrients (Bucha et al. 2020). For example, this study found that Euryarchaeota phylum in profuse and rare taxa may prefer increased NH4+, and Firmicutes phylum in profuse and rare taxa may prefer increased organic carbon. Increased organic carbon stimulated the development of the profuse and rare genera associated with Firmicutes in bituminous coals, including the profuse bacterial genera
Firmicutes were often detected in coal seams with high microbial abundance (Midgley et al. 2010; Wang et al. 2019b; Bucha et al. 2020), which played a vital role in coal decomposition. These groups were the main active heterotrophic and syntrophic bacterial consortia and dominated kerogen degradation, and the abundance of these fermentation bacteria can even restrict the generation of coal biomethane (Meslé et al. 2013). In addition, it was key that nutrients increased the methanogenic archaea, particularly the profuse archaea genera
The positive interaction in a co-occurrence network was mainly regarded as cooperation (Ju et al. 2014). In this study, there were more positive connections (profuse-profuse, rare-rare, and profuse-rare) than negative connections, and the number of negative connections in the treatment group was lower than that in the ck group. In coals, the interactions between microorganisms might be an important factor in maintaining the stability of underground communities (Abreu and Taga 2016). Frequent cooperation within profuse and/ or rare taxa may contribute to community resilience in changing environments because of the buffering function of the interaction network among microbes against environmental disturbances (Konopka et al. 2015). In addition, nutrients can enhance the interaction between rare taxa, including archaea (particularly methanogenic archaea) and bacteria with profuse taxa, which may be another potential factor influencing yield enhancement of biogenic coalbed methane. The process of biological methane production in coals requires the collective action of microorganisms involving at least three major metabolic groups, including hydrolyzing and fermenting bacteria, hydrogen- and acetogen-producing bacteria, and methanogenic archaea (Wang et al. 2018; Vick et al. 2019). To our knowledge, bacteria attach to the surface of the coal seams (Vick et al. 2016; McLeish et al. 2021) and drive the anaerobic fermentation of these organic materials in coal seams (Strąpoć et al. 2008; Penner et al. 2010). Methanogens also require bacterial partners to depolymerize and oxidize complex organic molecules into simple fermentation products (CO2, H2, acetate, formate, or other compounds). For methanogenic archaea in coal seams, symbiosis and aggregation with bacteria may be the main factor impacting their survival and sustainable methane production in coal seams (He et al. 2020).
Stochastic processes drive the most rich and rare communities in coals. Similarly, in many cases, microbial community changes may occur due to stochastic processes in communities via historical contingency (such as priority effects), ecological drift, and/or dispersal limitation (Chase 2010; Ofiţeru et al. 2010; Zhou et al. 2014; Evans et al. 2017). In previous experiments adding nutrients directly affected the carbon and nitrogen in the coal environments and caused changes in the microbial community. Thus, intuitively, the microbial community structure governed by environmental conditions such as the nutrients in this study should be referred to as deterministic processes (Fargione et al. 2003). It is despite the nutrient group increasing dispersal limitation (a stochastic process) for profuse and rare microbial community assembly and only increasing the variable selection (a deterministic process) for rare microbial community assembly. A previous study considered that stochastic processes could play more important roles than the functional differences of species in community pattern generation (Zhou and Ning 2017). The samples selected for this study came from coal seams in different regions, and dispersal limitation is the most important factor shaping large-scale biogeographic patterns (Hanson et al. 2012; Meyer et al. 2018). In addition, the increased contribution of variable selection by nutrient stimulation in the rare community suggested that heterogeneous abiotic and biotic factors, particularly chemical properties, can impose selective solid pressure by filtering rare species (Li et al. 2021) and drive changes in rare community compositions (Bottos et al. 2018). Nutrients have been demonstrated to drive a highly deterministic process for rare groups in various ecosystems and influence the diversity of rare microbial communities (He et al. 2018; Guo et al. 2020; Cao et al. 2021; San Roman and Wagner 2021).
In conclusion, this study is the first to focus on the assembly processes of profuse and rare microbial communities in coals under nutrient stimulation and showed that dispersal limitation played an important role in changing the profuse and rare microbial communities in coals. Nutrient stimulation intensified the relative contribution of dispersal limitation for both profuse and rare microbial community assemblages. It is the most crucial reason for shifts in microbial community diversity. In addition, nutrients increased the variable selection for rare microbial community assembly and enhanced the role of rare groups in the microbial co-occurrence network. Overall, this study strengthened our knowledge of the mechanistic response of coal microbial diversity and community composition to nutrient stimulation.