Characterization of Two Macrolide Resistance-Related Genes in Multidrug-Resistant Pseudomonas aeruginosa Isolates
, , , , , , , , , , , und
08. Sept. 2020
Über diesen Artikel
Artikel-Kategorie: original-paper
Online veröffentlicht: 08. Sept. 2020
Seitenbereich: 349 - 356
Eingereicht: 14. Mai 2020
Akzeptiert: 15. Aug. 2020
DOI: https://doi.org/10.33073/pjm-2020-038
Schlüsselwörter
© 2020 Qing Chen et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Primers used in this study for the detection of macrolide resistance-related genes_
Gene | Primer | Sequence (5’→3’) | Purpose | Restriction endonuclease | Vector | Amplicon size (bp) | Annealing temperature |
---|---|---|---|---|---|---|---|
ATGCCCAGCATATAAATCGC | Screening | 271 | 60°C | ||||
ATATGGACAAAGATAGCCCG | |||||||
CGGAATTCTATTCAAAAAAACTTATCCGACTTA | Cloning | pUCP18 | 885 | 60°C | |||
CCAAGCTTTTATATAACTCCCAACTGAGCTTTT | |||||||
TATAGCGACTTTAGCGCCAA | Screening | 395 | 62°C | ||||
GCCGTAGAATATGAGCTGAT | |||||||
CGGAATTCTTTTTGGGAGGACACTGTGATGCTA | Cloning | pUCP18 | 1,467 | 62°C | |||
CCAAGCTTTTATATAACTCCCAACTGAGCTTTT |
Coverage and abundance of the macrolide resistance genes in the pooled DNA from 262 Pseudomonas aeruginosa isolates_
Genotype | Reference sequence | Coverage | Abundance |
---|---|---|---|
AY522431 | 1.00 | 26.0 | |
AY522431 | 1.00 | 24.0 |
The MIC values for 13 antibiotics against 262 clinical Pseudomonas aeruginosa isolates_
Antibiotics | MIC range (μg/ml) | MIC50 (μg/ml) | MIC90 (μg/ml) | Resistance (%) |
---|---|---|---|---|
Cefuroxim | 0.5–32 | 16 | > 32 | 44.1 |
Cefepime | 1–64 | 8 | 64 | 36.7 |
Meropenam | 0.0125–32 | 4 | 32 | 30.1 |
Ceftazidime | 1–64 | 16 | > 64 | 52.1 |
Gentamicin | 0.125–64 | 16 | 64 | 32.1 |
Tobramycin | 0.5–32 | 4 | > 32 | 29.6 |
Amikacin | >256 | 2 | > 256 | 34.9 |
Netilmicin | 0.5–512 | 8 | > 512 | 42.1 |
Colistin | 0.25–16 | 2 | > 16 | 28.2 |
Azithromycin | 0.5–256 | 64 | > 256 | 78.1 |
Clarithromycin | 1–1024 | 256 | > 1024 | 69.5 |
Roxithromycin | 0.5–1024 | 256 | > 1024 | 76.8 |
Erythromycin | 1–1024 | 512 | > 1024 | 82.1 |
Amino acid polymorphisms in the MsrE variants_
Accession No. | Amino acid position | Reference | ||||||
---|---|---|---|---|---|---|---|---|
45 | 79 | 80 | 128 | 183 | 198 | 444 | ||
MG585957.1 | Ser | Glu | Thr | Ser | Glu | Glu | Ile | Gonzalez-Plaza et al. 2018 |
MG585949.1 | Ile | Asp | Gonzalez-Plaza et al. 2018 | |||||
CP032136.1 | Asp | |||||||
LS992184.1 | Gly | Asp | ||||||
CP026233.1 | Asp | Val | Weingarten et al. 2018 | |||||
CP021960.1 | Lys | Asp | ||||||
CP011374.1 | Gly | Asp | Lys | |||||
MsrE-2276 | Asp | this study | ||||||
MsrE-2883 | Asp | this study |
Amino acid polymorphisms in the MphE variants_
Accession No. | Amino acid position | Reference | |||
---|---|---|---|---|---|
17 | 28 | 133 | 231 | ||
CP029638.1 | Ile | Ile | Glu | Thr | Beker et al. 2018 |
CP035931.1 | Leu | ||||
KX443408.1 | Leu | Asp | |||
CP011374.1 | Leu | Leu | Ile | ||
Leu | this study | ||||
Leu | this study |
MIC results for the recombinants, clinical strains, and controls (μg/ml)_
Strain | ERY | KIT | ROX | CLR | AZM |
---|---|---|---|---|---|
pUCP18- | 512 | 256 | 1024 | 256 | 32 |
pUCP18-msrE/DH5α (PAO2883) | 512 | 512 | 1024 | 256 | 32 |
pUCP18- | 512 | 256 | 1024 | 256 | 32 |
pUCP18- | 512 | 512 | 1024 | 256 | 32 |
PAO2883 | 1024 | 512 | 1024 | 512 | > 128 |
PAO2276 | 512 | 256 | 1024 | 512 | > 128 |
PAO1609 | > 1024 | 256 | 1024 | 512 | > 128 |
pUCP18/DH5α | 128 | 256 | 128 | 32 | 4 |
DH5α | 128 | 512 | 128 | 32 | 4 |
ATCC 27853 | 32 | 16 | 64 | 16 | < 1 |