Uneingeschränkter Zugang

Investigation of GSTP1 and PTEN gene polymorphisms and their association with susceptibility to colorectal cancer

Durr-e-Shahwar,

Durr-e-Shahwar,

Biochemistry Section, Institute of Chemical Sciences, University of PeshawarPeshawar, Pakistan
Suche nach diesem Autor auf
Sciendo|Google Scholar
Durr-e-Shahwar,
, 
Hina Zubair

Hina Zubair

Biochemistry Section, Institute of Chemical Sciences, University of PeshawarPeshawar, Pakistan
Suche nach diesem Autor auf
Sciendo|Google Scholar
Zubair, Hina
, 
Muhammad Kashif Raza

Muhammad Kashif Raza

  • Biochemistry Section, Institute of Chemical Sciences, University of PeshawarPeshawar, Pakistan
  • Department of Chemistry, Shaheed Benazir Bhutto University Sheringal Dir upperSringeri, Pakistan
Suche nach diesem Autor auf
Sciendo|Google Scholar
Raza, Muhammad Kashif
, 
Zahid Khan

Zahid Khan

Biochemistry Section, Institute of Chemical Sciences, University of PeshawarPeshawar, Pakistan
Suche nach diesem Autor auf
Sciendo|Google Scholar
Khan, Zahid
, 
Lamjed Mansour

Lamjed Mansour

Department of Zoology, College of Science, King Saud UniversityRiyadh, Saudi Arabia
Suche nach diesem Autor auf
Sciendo|Google Scholar
Mansour, Lamjed
, 
Aktar Ali

Aktar Ali

Biological Screening Core, Warren Family Center for Drug Discovery, University of Notre DameNotre Dame, United States
Suche nach diesem Autor auf
Sciendo|Google Scholar
Ali, Aktar
 und 
Muhammad Imran

Muhammad Imran

Biochemistry Section, Institute of Chemical Sciences, University of PeshawarPeshawar, Pakistan
Suche nach diesem Autor auf
Sciendo|Google Scholar
Imran, Muhammad
  
04. Jan. 2025
Investigation of GSTP1 and PTEN gene polymorphisms and their association with susceptibility to colorectal cancer's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
COVER HERUNTERLADEN
Artikel-Kategorie: research article
Online veröffentlicht: 04. Jan. 2025
Seitenbereich: 110 - 120
Eingereicht: 12. Juli 2024
Akzeptiert: 25. Okt. 2024
DOI: https://doi.org/10.2478/raon-2025-0001
Schlüsselwörter
© 2025 Durr-e-Shahwar et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

FIGURE 1.

GSTP1Alleles frequency distribution of the rs1695 A/G (A) and rs1138272 C/T (B). CRC = colorectal cancer
GSTP1Alleles frequency distribution of the rs1695 A/G (A) and rs1138272 C/T (B). CRC = colorectal cancer

FIGURE 2.

GSTP1 genotypic count of the overall participants for rs1695 and rs1138272. The p-values and odds ratio (OR) displayed in the figure correspond to pairwise comparisons of genotypes in between the two groups. Lines typically represent trends or connections between data points and square dots mark data points or average. Genotype count means number of individuals with a specific genetic variation. CI = confidence interval
GSTP1 genotypic count of the overall participants for rs1695 and rs1138272. The p-values and odds ratio (OR) displayed in the figure correspond to pairwise comparisons of genotypes in between the two groups. Lines typically represent trends or connections between data points and square dots mark data points or average. Genotype count means number of individuals with a specific genetic variation. CI = confidence interval

FIGURE 4.

PTEN genotypic count of the overall participants for rs701848 and rs2735343. The p-values and odds ratio (OR) displayed in the figure correspond to pairwise comparisons of genotypes between the two groups in each of the bar graphs. Lines typically represent trends or connections between data points and square dots mark data points or average. Genotype count means number of individuals with a specific genetic variation. CI = confidence interval
PTEN genotypic count of the overall participants for rs701848 and rs2735343. The p-values and odds ratio (OR) displayed in the figure correspond to pairwise comparisons of genotypes between the two groups in each of the bar graphs. Lines typically represent trends or connections between data points and square dots mark data points or average. Genotype count means number of individuals with a specific genetic variation. CI = confidence interval

FIGURE 3.

PTEN Alleles frequency distribution of the rs701848 T/C (A) and rs2735343 C/G (B). CRC = colorectal cancer
PTEN Alleles frequency distribution of the rs701848 T/C (A) and rs2735343 C/G (B). CRC = colorectal cancer

Frequency of PTEN (rs2735343) polymorphism and its association with colorectal cancer (CRC) risk

Models/Genotype CRC Patients +Healthy Controls n (%) CRC Patients n (%) Healthy Controls n (%) OR P Value 95% CI RR
Overall Subjects
Codominant Model
  C/C 215 (48) 40 (20) 175 (70) Referent _
  C/G 77 (17) 35 (18) 42 (17) 3.6 < 0.01* 2.06–6.42 0.2
  G/G 158 (35) 125 (62) 33 (13) 17.0 < 0.01* 10.0–28.0 0.1
Dominant
  C/G+G/G 235 (52) 160 (80) 75 (30) 9.5 < 0.01* 6.10–14.7 0.4
Recessive Model (C/C+C/G) 292 75 217 0.09 < 0.01* 0.05–0.14 -
Over dominant Model
  (C/G) 77 (17) 35 (18) 42 (17) 1.09 0.71 0.67–1.79 -
Male
  C/C 139 (48) 24 (20) 115 (68) Referent _
  C/G 47 (16) 16 (13) 31 (18) 2.47 < 0.01* 1.17–5.22 0.2
  G/G 105 (36) 82 (67) 23 (14) 17.08 < 0.01* 9.02–32.3 0.2
Dominant
  C/G+G/G 152 (52) 98 (80) 54 (32) 8.70 < 0.01* 5.01–15.0 0.4
Female
  C/C 76 (48) 16 (21) 60 (74) Referent _
  C/G 30 (19) 19 (24) 11 (14) 6.48 < 0.01* 2.57–16.3 0.1
  G/G 53 (33) 43 (55) 10 (12) 16.12 < 0.01* 6.68–38.9 0.1
Dominant
  C/G+G/G 83 (52) 62(79) 21 (26) 11.07 < 0.01* 5.28–23.3 0.3
HWE (Genotype Frequencies)
  C2 0.12 0.24 0.05 - - -
  2CG 0.45 0.5 0.35 - - -
  G2 0.42 0.26 0.59 - - -
  χ2total = 1

Frequency of PTEN (rs701848) polymorphism and its association with colorectal cancer (CRC) risk

Models/Genotype CRC Patients +Healthy Controls n (%) CRC Patients n (%) Healthy Controls n (%) OR P Value 95% CI RR
Overall Subjects
Codominant Model
  T/T 293 (65) 136 (68) 157 (63) Referent _
  T/C 113 (25) 30 (15) 83 (33) 0.41 0.03* 0.25–0.67 0.5
  C/C 44 (10) 34 (17) 10 (4) 3.92 0.03* 1.86– 8.23 0.06
Dominant
  T/C+C/C 157 (35) 64 (32) 93 (37) 0.79 0.25 0.53–1.17 0.5
Recessive Model (T/T+T/C) 406 166 240 0.20 < 0.01* 0.09–0.42 -
Over dominant Model
  (T/C) 113 (25) 30 (15) 83 (33) 0.35 < 0.01* 0.22–0.56 -
Male
  T/T 197 (68) 86 (70) 111 (66) Referent
  T/C 71 (24) 17 (14) 54 (32) 0.40 0.04* 0.21–0.75 _
  C/C 23 (8) 19 (16) 04 (2) 8.02 0.01* 2.29-28.01 0.04
Dominant
  T/C+C/C 94 (32) 36 (30) 58 (34) 0.81 0.42 0.49–1.35 0.5
Female
  T/T 96 (60) 50 (64) 46 (57) Referent _
  T/C 42 (27) 13 (17) 29 (36) 0.41 0.02* 0.19–0.89 0.6
  C/C 21 (13) 15 (19) 06 (7) 2.05 0.14 0.77-5.48 0.1
Dominant T/C+C/C 63 (40) 28 (36) 35 (43) 0.72 0.32 0.38–1.36 0.7
HWE (Genotype Frequencies)
  T2 0.04 0.04 0.03 - - -
  2TC 0.34 0.32 0.29 - - -
  C2 0.60 0.64 0.67 - - -
  χ2total = 1

Association of GSTP1 and PTEN polymorphism with colon and rectum cancer cases

Gene/rs Genotype Colon n = 102 (%) Rectum n = 98 (49%) P Value
GSTP1 rs1695 AA 62 (61.11) 26 (27.00) Referent
AG 34 (33.33) 72 (73.33) < 0.01*
GG 06 (5.65) - 0.25
GSTP1 rs1138272 CC 91 (89) 69 (69.5) Referent
CT 13 (13.0) 17 (17.3) < 0.01*
TT 17 (17.0) 17 (17.3) 0.27
PTEN rs701848 TT 72 (70.0) 64 (65.4) Referent
TC 13 (13.0) 17 (17.3) < 0.01*
CC 17 (17.0) 17 (17.3) 0.02
PTEN rs2735343 CC 20 (19.6) 20 (20.4) Referent
CG 19 (18.6) 16 (16.3) 0.71
GG 63(61.8) 62 (63.3) 0.96

Primer sequences and amplification conditions for GSTP1 and PTEN polymorphisms

Gene Primer sequence PCR conditions Amplicon length (bp) Restriction enzyme Length of digest products (bp) Enzyme specificity
GSTP1 (rs1695) F:5′GGCTCTATGGGAAGGACCAGCAGG-3′ R:5′GCACCTCCATCCAGAAACTGGCG3′ 30 cycles of 1 min at 94°C,1 min at 66°C and 2 min at 72°C. 445 Alw261 330+115+270 5’GTCTC(N)1↓3’3’CAGAG(N) 5↑5’
GSTP1 (rs1138272) F:5′CAGCAGAGGCAGCGTGTGTGC-3′ R:5′CCCACAATGAAGGTCTTGCCTCC-3′ 30 cycles of 1 min at 94°C, 1 min at 64°C and 2 min at 72°C. 565 AciI 365+120+485+80 5’C↓CG↑C’3 3’G↓GC↑G’5
PTEN (rs701848) F:5’-GTGCTTTATTGATTTGCT-3’ R:5’AGTAGTTGTACTCCGCTT-3’ 5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 55°C, 30 s at 72°C, and10 min extension at 72°C. 199 HaeIII 199+81+118 5’GG↑CC3’3’CC↑G G5’
PTEN (rs2735343) F:5’-CTCTTCCTGTTCTCCATCGTG-3’ R:5’-TTCTCCAGGATTTCGTCTGC-3’ 5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 63°C, 30 s at 72°C and 10 min at 72°C. 272 HhaI 272+72+200 5’G↑CG↑C3’ 3’C↑GC↑G’5

Frequency of GSTP1 (rs1695) polymorphism and its association with colorectal cancer (CRC) risk

Models/Genotype CRC Patients + Healthy Controls n (%) CRC Patients n (%) Healthy Controls n (%) OR P Value 95% CI RR
Overall Subjects
Codominant Model
A/A 192 (43) 91 (46) 101 (40) Referent _
A/G 231 (51) 102 (51) 129 (52) 0.88 0.10 0.60–1.29 1.2
G/G 27 (6) 07 (4) 20 (8) 0.39 0.10 0.16–0.97 0.2
Dominant Model (A/G+G/G) 258 (57) 109 (54) 149 (60) 0.81 0.28 0.56–1.19 1.4
Recessive Model (A/A+A/G) 423 193 230 2.39 0.05* 0.99–5.79 -
Over dominant Model (A/G) 231 (51) 102 (51) 129 (52) 1.02 0.89 0.70–1.48 -
Male
A/A 123 (42) 58 (48) 65 (38) Referent _
A/G 150 (52) 63 (52) 87 (51) 0.81 < 0.01* 0.50–1.31 1.3
G/G 18 (6) 01 (0.1) 17 (1) 0.07 < 0.01* 0.01–0.51 0.2
Dominant Model (A/G+G/G) 168 (58) 64 (52) 104 (52) 0.69 0.12 0.43–1.11 1.5
Female
A/A 69 (43) 33 (42) 36 (44) Referent _
A/G 81 (51) 39 (50) 42 (52) 1.01 0.55 0.53–1.93 1.1
G/G 9 (6) 06 (8) 03 (4) 2.18 0.55 0.50–9.43 0.1
Dominant Model (A/G+G/G) 90 (57) 45 (58) 45 (56) 1.09 0.79 0.58–2.04 1.2
HWE (Genotype Frequencies)
A2 0.46 0.50 0.436 - - -
2AG 0.43 0.41 0.449 - - -
G2 0.10 0.08 0.116 - - -
χ2total = 1

Demographic information and risk factors in colorectal cancer (CRC) cases and control

Variable Patients N = 200(%) Control n = 250(%) P value
*Age (Years)
≥ 40 132 (66.0) 151 (60.4) 0.222
< 40 68 (34.0) 99 (39.6)
Range 10-60 11-60 -
Median 46 32 -
*Gender
Male 122 (61.1) 169(68) 0.273
Female 78 (39.0) 81(32)
**Smoking status
Never 165 (82.3) 22 (8.8) < 0.010
Ever 35 (17.6) 228 (91.1)
*Site of tumor
Colon 102(51.00) 0.984
Rectum 98(49.00)

Frequency of GSTP1(rs1138272) polymorphism and its association with colorectal cancer (CRC) risk

Models/Genotype CRC Patients +Healthy Controls n (%) CRC Patients n (%) Healthy Controls n (%) OR P Value 95% CI RR
Overall Subjects
Codominant Model
  C/C 350 (78) 161(80) 189(76) Referent _
  C/T 90 (20) 35(18) 55(22) 0.74 0.12 0.46-1.19 0.2
  T/T 10 (2) 4(2) 6 (2) 0.78 0.70 0.21-2.82 0.03
Dominant Model C/T+T/T 100 (22) 39 (19) 61 (24) 0.75 0.21 0.47-1.18 0.3
Recessive Model (C/C+C/T) 440 196 244 1.20 0.77 0.33-4.32 -
Over dominant Model
  (C/T) 90 (20) 35(18) 55(22) 0.75 0.23 0.46-1.20 -
Male
  C/C 229(79) 98(80) 131(78) Referent -
  C/T 56(19) 20(17) 36(21) 0.74 0.33 0.40-1.36 0.2
  T/T 6(2) 4(3) 02(1) 2.67 0.26 0.47-14.89 0.02
Dominant Model C/T+T/T 62(21) 24(20) 38(22) 0.84 0.56 0.47-1.49 0.2
Female
  C/C 121(76) 61(78) 60(74) Referent _
  C/T 34(21) 15(19) 19(24) 0.77 0.51 0.36-1.66 0.3
  T/T 4(3) 2(3) 02(2) 0.98 0.98 0.13-7.21 0.04
Dominant Model C/T+T/T 38(24) 17(22) 21(26) 0.88 0.74 0.43-1.82 0.3
HWE (Genotype Frequencies)
  C2 0.462 0.81 0.25 - - - -
  2CT 0.435 0.18 0.5 - - - -
  T2 0.102 0.01 0.25 - - - -
  χ2total = 1
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Medizin, Klinische Medizin, Allgemeinmedizin, Innere Medizin, Hämatologie, Onkologie, Radiologie
Zeitschrift RSS Feed