Uneingeschränkter Zugang

The small non-coding RNA rli106 contributes to the environmental adaptation and pathogenicity of Listeria monocytogenes

Yun Guo

Yun Guo

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Guo, Yun
, 
Chunhui Ji

Chunhui Ji

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Ji, Chunhui
, 
Lixia Wang

Lixia Wang

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Wang, Lixia
, 
Chengcheng Ning

Chengcheng Ning

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Ning, Chengcheng
, 
Na Li

Na Li

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Li, Na
, 
Zhiyuan Li

Zhiyuan Li

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Li, Zhiyuan
, 
Yunxia Shang

Yunxia Shang

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Shang, Yunxia
, 
Yaling Li

Yaling Li

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Li, Yaling
, 
Yaoqiang Sun

Yaoqiang Sun

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Sun, Yaoqiang
, 
Xiaoxing Huang

Xiaoxing Huang

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Huang, Xiaoxing
, 
Jie Li

Jie Li

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Li, Jie
, 
Xuepeng Cai

Xuepeng Cai

State Key Lab of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural SciencesGansu, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Cai, Xuepeng
, 
Qingling Meng

Qingling Meng

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Meng, Qingling
 und 
Jun Qiao

Jun Qiao

College of Animal Science and Technology, Shihezi UniversityXinjiang, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Qiao, Jun
  
17. März 2023
The small non-coding RNA rli106 contributes to the environmental adaptation and pathogenicity of Listeria monocytogenes's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
COVER HERUNTERLADEN
Online veröffentlicht: 17. März 2023
Seitenbereich: 67 - 77
Eingereicht: 01. Apr. 2022
Akzeptiert: 03. März 2023
DOI: https://doi.org/10.2478/jvetres-2023-0013
Schlüsselwörter
© 2023 Y. Guo et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Growth curves of LM strains under different environmental stresses. LM EGD-e – parental strain of Listeria monocytogenes; LM-△rli106 – rli106 deletion strain of Listeria monocytogenes; CLM-△rli106 – rli106 complementation strain of Listeria monocytogenes A–F – Growth curves of LM EGD-e, LM-△rli106 and CLM-△rli106 under the conditions of 42°C, pH 9, 5% NaCl and 8% NaCl, 3.8% ethanol and 5 mM H2O2. Bars indicate the standard error of the mean
Growth curves of LM strains under different environmental stresses. LM EGD-e – parental strain of Listeria monocytogenes; LM-△rli106 – rli106 deletion strain of Listeria monocytogenes; CLM-△rli106 – rli106 complementation strain of Listeria monocytogenes A–F – Growth curves of LM EGD-e, LM-△rli106 and CLM-△rli106 under the conditions of 42°C, pH 9, 5% NaCl and 8% NaCl, 3.8% ethanol and 5 mM H2O2. Bars indicate the standard error of the mean

Fig. 2

Determination and comparisons of the motility of different strains of LM. LM EGD-e – parental strain of Listeria monocytogenes; LM-△rli106 – rli106 deletion strain of Listeria monocytogenes; CLM-△rli106 – rli106 complementation strain of Listeria monocytogenes A – Kinetics of LM EGD-e (1), LM-△rli106 (2) and CLM-△rli106 (3) in semi-solid medium; B – Kinetics in tablets; C – Diameter size of the bacterial colony on the plate; ns – not significant, P > 0.05. Bars indicate the standard error of the mean
Determination and comparisons of the motility of different strains of LM. LM EGD-e – parental strain of Listeria monocytogenes; LM-△rli106 – rli106 deletion strain of Listeria monocytogenes; CLM-△rli106 – rli106 complementation strain of Listeria monocytogenes A – Kinetics of LM EGD-e (1), LM-△rli106 (2) and CLM-△rli106 (3) in semi-solid medium; B – Kinetics in tablets; C – Diameter size of the bacterial colony on the plate; ns – not significant, P > 0.05. Bars indicate the standard error of the mean

Fig. 3

Effects of rli106 gene deletion on biofilm formation of LM A – Formation of biofilm by the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106) at 12 h, 24 h and 48 h; B – Comparison of biofilm formation at 12 h, 24 h and 48 h. Bars indicate the standard error of the mean (SE); ** – P < 0.01
Effects of rli106 gene deletion on biofilm formation of LM A – Formation of biofilm by the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106) at 12 h, 24 h and 48 h; B – Comparison of biofilm formation at 12 h, 24 h and 48 h. Bars indicate the standard error of the mean (SE); ** – P < 0.01

Fig. 4

Determination of adhesion, invasion and intracellular viability in RAW264.7 macrophages for the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106). A – Adhesion rate of LM EGD-e, LM-△rli106 and CLM-△rli106 in RAW264.7 cells; B – Invasion rate of LM EGD-e, LM-△rli106 and CLM-△rli106 in RAW264.7 cells; C – Determination of intracellular viability in macrophages. Bars indicate the standard error of the mean (SE); ** – P < 0.01
Determination of adhesion, invasion and intracellular viability in RAW264.7 macrophages for the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106). A – Adhesion rate of LM EGD-e, LM-△rli106 and CLM-△rli106 in RAW264.7 cells; B – Invasion rate of LM EGD-e, LM-△rli106 and CLM-△rli106 in RAW264.7 cells; C – Determination of intracellular viability in macrophages. Bars indicate the standard error of the mean (SE); ** – P < 0.01

Fig. 5

Effects of rli106 gene deletion on virulence of LM. A – Survival curves of mice infected with the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106); B and C – Bacterial loads in the livers and spleens of mice infected by LM EGD-e, LM-△rli106 and CLM-△rli106; bars indicate the standard error of the mean (SE); * – P < 0.05; ** – P < 0.01 (LM EGD-e)
Effects of rli106 gene deletion on virulence of LM. A – Survival curves of mice infected with the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106); B and C – Bacterial loads in the livers and spleens of mice infected by LM EGD-e, LM-△rli106 and CLM-△rli106; bars indicate the standard error of the mean (SE); * – P < 0.05; ** – P < 0.01 (LM EGD-e)

Fig. 6

Histopathological examination of liver, spleen and kidney of mice infected by LM strains (haematoxylin and eosin staining, ×400). LM EGD-e – parental strain of Listeria monocytogenes rli106; LM-△rli106 – rli106 deletion strain of Listeria monocytogenes; CLM-△rli106 – rli106 complementation strain of Listeria monocytogenes
Histopathological examination of liver, spleen and kidney of mice infected by LM strains (haematoxylin and eosin staining, ×400). LM EGD-e – parental strain of Listeria monocytogenes rli106; LM-△rli106 – rli106 deletion strain of Listeria monocytogenes; CLM-△rli106 – rli106 complementation strain of Listeria monocytogenes

Fig. 7

Verification of interaction between rli106 sRNA and mRNA of target gene DegU. A – Complementary pairing position of DegU target gene and rli106; B and C – Bacterial lawns of BTH101 co-transformed by pUT18C and pMR-LacZ-DegU, and BTH101 co-transformed by pUT18C-rli106 and pMR-LacZ-DegU; D – OD420 nm of bacterial lawns; E – mRNA level of DegU target gene in the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106); F and G – protein level of DegU in LM EGD-e, LM-△rli106 and CLM-△rli106
Verification of interaction between rli106 sRNA and mRNA of target gene DegU. A – Complementary pairing position of DegU target gene and rli106; B and C – Bacterial lawns of BTH101 co-transformed by pUT18C and pMR-LacZ-DegU, and BTH101 co-transformed by pUT18C-rli106 and pMR-LacZ-DegU; D – OD420 nm of bacterial lawns; E – mRNA level of DegU target gene in the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106); F and G – protein level of DegU in LM EGD-e, LM-△rli106 and CLM-△rli106

Primers used in the study

Primer name Primer sequences (5′→3′) Product size (bp)
rli106F GCCTCTTTGCAATCGAAA
rli106R ACTACTATTACTTTAGACTAGTTTTCAATT 225
P1 GGTACC AAATAGCCGACTGCTCCAGC
P2 AAATTCGTGTTATAATAAAATTGGTGAAATTAGATAAGTG 351
P3 CACTTATCTAATTTCACCAATTTTATTATAACACGAATTT
P4 CTGCAG GATCTCTAGCATTGGAAAGCCA 383
P5 AAATAGCCGACTGCTCCAGC
P6 GATCTCTAGCATTGGAAAGCCA 722
P7 CCGTGCTTGATTGCCGTTAC
P8 AACTAGGCCGCCTGCACC 1391/1166
CF AAGCTTGCCTCTTTGCAATCGAAA
CR CGGGATCCACTACTATTACTTTAGACTAG 239
rli106F1 GGATCCCAGTTGGCATATTAATATC
rli106R1 CGGGGTACCGGTTAAGCGGTTTTGC 271
DegUF CAAGCTTAAAAGAGAAATGTTTAATT
DegUR GGTACCACTGTTTTTTCACTAATGA 721
16S rRNAF GATGCATAGCCGACCTGAGA
16S rRNAR TGCTCCGTCAGACTTTCGTC 116
hemCF CGGATCCATGACGTTATCTAAAGGA
hemCR CCAAGCTTTTAAATTCGTTCTTCTACA 1122
DegUF1 GGATCCATGGCACTCAAAATCATGATTG
DegUF2 CAAGCTTTTAGCGAATGTATACCCAGCC 687
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Molekularbiologie, Mikrobiologie und Virologie, Biologie, andere, Medizin, Veterinärmedizin
Zeitschrift RSS Feed