Occurrence of bovine coronavirus and other major respiratory viruses in cattle in Poland
Online veröffentlicht: 04. Nov. 2022
Seitenbereich: 479 - 486
Eingereicht: 03. Juni 2022
Akzeptiert: 19. Okt. 2022
DOI: https://doi.org/10.2478/jvetres-2022-0059
Schlüsselwörter
© 2022 W. Socha et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Coronaviruses are RNA viruses that can infect multiple mammalian and avian species causing respiratory, enteric, hepatic and neurological diseases. As their genome is characterised by a high mutation rate, they are able to adapt quickly to novel hosts and ecological niches. This has become especially evident in recent years with the occurrence of local outbreaks of severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV) and the global pandemic of SARS-CoV-2 (29). Bovine coronavirus (BCoV) belongs to the
Additionally, while the importance of the interaction between different pathogens is widely recognised, including the significance of BCoV in the occurrence of BRDC, no studies on coinfections with multiple respiratory viruses have been performed in Poland in recent years (11, 16). The aim of the study was to investigate the prevalence of co-occurring infections with the three viruses BCoV, BVDV and BoHV-1 in selected cattle herds in Poland among both healthy animals and those showing signs of respiratory disease. As a follow-up, sequences of BCoV isolates were characterised for the first time in the country.
A real-time reverse transcriptase RT-PCR for BCoV detection was run using previously described primers specific to the gene encoding the M protein (6). Additionally, for internal control, a 200 μL mix of primers and probes specific to β-actin was prepared consisting of 5 μL of 100 μM ACT-1005-F and ACT-1135-R primers, 3.75 of 100 μM ACT-1081-HEX probe and 186.25 μL of water (24). The reaction was run in 20 μL of reaction mix that comprised 6.3 μL of water, 4 μL of 5× QuantiTect Virus Master Mix (Qiagen), 2 μL of each BCoV-specific forward and reverse primer (10 μM), 2 μL of BCoV-specific probe (5 μM), 1.5 μL of a mixture of primers and probes specific to bACT, 0.2 μL of 100 QuantiTect Virus RT Mix (Qiagen) and 2 μL of RNA sample. After 30 min of reverse transcription at 42°C and a 10 min incubation at 95°C, 40 cycles of amplification were run each consisting of 15 s of denaturation at 95°C and 45 s of annealing/elongation at 58°C.
A real-time PCR specific to BoHV-1 was run using previously described primers specific to the gene encoding glycoprotein gD (26). The reaction was run in 25 μL of a mix that included 14.5 μL of water, 5 μL of 5× QuantiTect Virus Master Mix (Qiagen), 1 μL of each BoHV-1 specific forward and reverse primer (10 μM), 1 μL of BoHV specific probe (10 μM) and 2.5 μL of DNA sample. The reaction started with a 5 min incubation at 50°C, and proceeded through 2 min at 95°C and 45 cycles of amplification consisting of 15 s of denaturation at 95°C and 45 s of annealing/elongation at 60°C.
A multiplex real-time PCR for BVDV-1 and 2 detection was performed using the primers specific to the 5ʹ untranslated region described by Baxi
All real-time PCR amplifications were performed using the LightCycler 96 Instrument (Roche, Mannheim, Germany). Sequences of primers used for detection of the viruses are presented in Table 1.
Primers and probes used for BCoV, BVDV, BoHV-1 and internal control amplification
Target | Primer/probe | Sequence (5′–3′) | Amplicon size (bp) | Gene/ protein | Reference |
---|---|---|---|---|---|
BCoV-F | CTGGAAGTTGGTGGAGTT | ||||
BCoV-R | ATTATCGGCCTAACATACATC | 85 | M/matrix | ||
BCoV | BCoV-Pb | FAM-CCTTCATATCTATACACATCAAGTTGTT-BHQ1 | (6) | ||
Sp1 | CTTATAAGTGCCCCCAAACTAAAT | ||||
Sp2 | CCTACTGTGAGATCACATGTTTG | 622 | S/spike | ||
Pesti-F | CTAGCCATGCCCTTAGTAG | ||||
Pesti-R | CGTCGAACCAGTGACGACT | ||||
BVDV | BVDV1 | FAM-TAGCAACAGTGGTGAGTTCGTTGGATGGCT-BHQ1 | 106 | 5′-UTR | (1) |
BVDV2 | TxR-TAGCGGTAGCAGTGAGTTCGTTGGATGGCC-BHQ1 | ||||
gD5595-F | CCGCCGTATTTTGAGGAGTCG | ||||
BoHV-1 | gD5704-R | TCGGTCTCCCCTTCRTCCTC | 46 | gD | (26) |
BHV1-gD-FAM* | FAM-TCGGTCTCCCCTTCRTCCTC-BHQ1 | ||||
ACT-1005-F | CAGCACAATGAAGATCAAGATCATC | ||||
β Actin | ACT-1135-R | CGGACTCATCGTACTCCTGCTT | 130 | bACT | (24) |
ACT-1081-HEX | HEX-TCGCTGTCCACCTTCCAGCAGATGT- BHQ1 |
BCoV – bovine coronavirus; F – forward; R – reverse; BVDV – bovine viral diarrhoea virus; Pesti – pestivirus; UTR – untranslated region; BoHV–1 – bovine herpesvirus 1; FAM – fluorescein amidite; * – modified; gD – glycoprotein D; bACT – β-actin; HEX – hexachlorofluorescein
Univariable analysis of bovine coronavirus (BCoV) seroprevalence in cows and presence of genetic material in nasal swabs (shedding) detected by reverse transcriptase RT-PCR
Variable | Seroprevalence | RT-PCR positive | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
% | 95% CI | P | % | 95% CI | χ2 | P | ||||
Age group* | 23.20 | <0.001 | 5.06 | 0.080 | ||||||
≤ 3 months | 16/89 | 82.0 | 73.9–90.1 | 14/89 | 15.7 | 8.0–23.4 | ||||
3–6 months | 102/126 | 81.0 | 74.0–87.9 | 12/126 | 9.5 | 4.3–14.7 | ||||
≥ 6 months | 25/51 | 49.0 | 34.8–63.2 | 2/51 | 3.9 | −1.6–9.4 | ||||
All | 201/261 | 77.0 | 71.4–82.0 | 29/261 | 11.1 | 7.6–15.6 | ||||
Sex | 0.006 | 0.940 | 2.90 | 0.088 | ||||||
Female | 89/120 | 74.2 | 65.6–87.1 | 7/120 | 5.8 | 2.4–11.6 | ||||
Male | 25/34 | 73.5 | 55.6–87.1 | 5/34 | 14.7 | 5.0–31.1 | ||||
All | 114/154 | 74.0 | 66.4–80.8 | 12/154 | 7.8 | 4.1–13.2 | ||||
Respiratory signs | 4.39 | 0.0361 | 3.23 | 0.072 | ||||||
Yes | 62/86 | 72.1 | 61.4–81.2 | 15/86 | 17.4 | 10.1–27.1 | ||||
No | 57/85 | 67.1 | 56.0–76.9 | 7/85 | 8.2 | 3.4–16.2 | ||||
All | 119/171 | 69.6 | 62.1–76.4 | 22/171 | 12.9 | 8.2–18.8 | ||||
BoHV–1 status | 13.97 | <0.001 | 0.084 | 9.772 | ||||||
Seropositive | 99/117 | 84.6 | 76.8–90.6 | 13/117 | 11.1 | 6.1–18.3 | ||||
Seronegative | 116/179 | 64.8 | 57.3–71.8 | 18/179 | 10.1 | 6.1–15.4 | ||||
All | 215/296 | 72.6 | 67.2–77.6 | 31/296 | 10.5 | 7.2–14.5 | ||||
BVDV status | 5.98 | 0.014 | 1.249 | 0.264 | ||||||
Seropositive | 113/144 | 78.5 | 70.9–84.9 | 18/144 | 12.5 | 7.6–19.0 | ||||
Seronegative | 93/142 | 65.5 | 57.1–73.3 | 12/142 | 8.4 | 4.4–14.3 | ||||
All | 206/286 | 72.0 | 66.4–77.2 | 30/286 | 10.5 | 7.2–14.6 | ||||
BoHV–1 PCR | 1.142 | 0.285 | 0.35 | 0.554 | ||||||
Positive | 3/3 | 100.0 | 29.2–100.0 | 0/3 | 0.0 | 0.0–70.8 | ||||
Negative | 212/293 | 72.3 | 66.9–77.4 | 31/293 | 10.6 | 7.3–14.7 | ||||
All | 215/296 | 72.6 | 76.2–77.6 | 31/296 | 10.5 | 7.2–14.5 | ||||
BVDV RT–PCR | 5.107 | 0.024 | 0.04 | 0.841 | ||||||
Positive | 3/8 | 37.5 | 8.5–75.5 | 1/8 | 12.5 | 0.3–52.7 | ||||
Negative | 212/288 | 73.6 | 68.1–78.6 | 30/288 | 10.4 | 7.1–14.5 | ||||
All | 215/296 | 72.6 | 67.2–77.6 | 31/296 | 10.5 | 7.2–14/5 | ||||
BCoV RT–PCR | 0.042 | 0.837 | ||||||||
Positive | 23/31 | 74.2 | 55.4–88.1 | |||||||
Negative | 192/265 | 72.4 | 66.7–77.7 | |||||||
All | 215/296 | 72.6 | 67.2–77.6 | |||||||
Herd size* | 29.34 | <0.001 | 10.35 | 0.006 | ||||||
Smaller (≤77) | 31/62 | 50.0 | 6.0–62.8 | 1/62 | 1.6 | −1.6–4.8 | ||||
Medium (80–590) | 128/158 | 81.0 | 74.8–87.2 | 19/158 | 12.0 | 6.9–17.1 | ||||
Larger (≥750) | 24/25 | 96.0 | 87.7–104.2 | 6/25 | 24.0 | 6.0–42.0 | ||||
All | 183/245 | 74.7 | 69.1–80.3 | 25/245 | 10.2 | 6.7–14.8 | ||||
Province | 12.65 | 0.013 | 13.04 | 0.011 | ||||||
Mazowieckie | 44/66 | 66.7 | 54.0–77.8 | 9/66 | 13.6 | 6.4–24.3 | ||||
Pomorskie | 42/60 | 70.0 | 56.8–81.1 | 2/60 | 3.3 | 0.4–11.5 | ||||
Opolskie | 58/70 | 82.8 | 71.9–90.8 | 5/70 | 7.1 | 2.4–15.9 | ||||
Podlaskie | 38/45 | 84.4 | 70.5–93.5 | 3/45 | 6.7 | 1.4–18.3 | ||||
Wielkopolskie | 33/55 | 60.0 | 46.0–73.0 | 12/55 | 21.8 | 11.8–35.0 | ||||
All | 215/296 | 72.6 | 67.2–77.6 | 31/296 | 10.5 | 7.2–14.5 |
The final generalised linear mixed model presenting risk factors of bovine coronavirus seropositivity in cattle (number of observations = 229)
Variable | Category | Odds ratio | β (SE) | P |
95% CI | |
---|---|---|---|---|---|---|
Age group* | ||||||
≤3 months | reference | |||||
3–6 months | 0.58 | 0.32 | −0.99 | 0.323 | 0.19–1.72 | |
≥6 months | 0.27 | 0.14 | −2.44 | 0.015 | 0.10–0.78 | |
Herd size* | ||||||
Smaller (≤77) | reference | |||||
Medium (80–590) | 5.20 | 2.93 | 2.91 | 0.004 | 1.71–15.72 | |
Larger (≥750) | 39.90 | 45.78 | 3.21 | 0.001 | 4.21–378.14 | |
Fixed effect | Variance | β (SE) | 95% CI | |||
Province | 0.95 | 0.87 | 0.16–5.76 |
SE – standard error;
The final generalised linear mixed model presenting risk factors of bovine coronavirus detection in nasal swabs from individual cattle by reverse transcriptase PCR (number of observations = 229)
Variable | Category | Odds ratio (OR) | β (SE) | P |
95% CI | |
---|---|---|---|---|---|---|
Herd size* | ||||||
Smaller (≤77) | reference | |||||
Medium (80–590) | 4.22 | 1.92 | 3.16 | 0.004 | 1.73–10.30 | |
Larger (≥750) | 0.02 | 0.02 | -4.24 | <0.001 | 0.002–0.11 | |
Fixed effect | Variance | β (SE)c | 95% CI | |||
Age group | 1.06 | 1.66 | 0.05–23.16 |
SE – standard error;

Neighbour-joining phylogenetic tree of sequences obtained in the study (19). The tree was constructed using a 601-nucleotide-long fragment of the gene encoding the spike protein of BCoV. Sequences acquired in this study are marked by black squares. The country and the date of isolation (when available) are included in the brackets next to each sequence res – respiratory isolate; ent – enteric isolate
Bovine coronavirus seemed to be the most common viral pathogen in the tested population, as almost three quarters of the tested animals were seropositive, and the virus was detected in 10.5% of nasal swabs. Similarly, high BCoV seroprevalence was observed in recent studies conducted in Norway and Sweden, where 72.2% and up to 85.3% of dairy herds were seropositive, respectively (23, 27). At the same time, a significant correlation was observed between respiratory signs and the presence of BCoV-specific antibodies. Respiratory signs were also more common in animals for which the presence of BCoV was confirmed in nasal swabs; however, this correlation was marginal and not statistically significant. Those ambiguous results are not uncommon for BCoV, and for this reason the role of this virus as the primary agent of BRDC remains controversial. Previous studies showed serological prevalence of over 90%, suggesting that most cattle become exposed to BCoV during their lifetime; however, the virus was identified in both healthy and diseased animals (4, 29). It is possible that, as was previously described, BCoV does not initiate the respiratory disease, but may trigger the process in case of coinfection with other respiratory pathogens (16). In our study, seropositivity to BCoV was more frequent among younger animals (calves at the age of ≤3 months and 3–6 months) and moreover, age was identified as one of the risk factors. The higher seropositivity among young animals contradicted previous results showing an increase in the BCoV seroprevalence with age of the animal (2). This discrepancy may arise from the retention of maternal antibodies by a significant part of the youngest age group in our study. Tuncer
Previous studies showed that a large herd size could be associated with a higher risk of BCoV seropositivity (12, 23). This was also observed in our study, as significant differences were found between herds of different sizes, with an increase in seroprevalence with the size of the herd. The herd size was also one of the risk factors for seroprevalence, and cases of active BCoV infections were detected more frequently in larger herds. It is possible that a larger number of animals favours the persistence of this virus in the herd, as it is more likely that susceptible individuals are present, creating better conditions for virus circulation. Additionally, it was suggested that larger herds could have more indirect contact with carriers and be at greater iatrogenic risk
Given the seroprevalence data, cattle are exposed more frequently to BCoV in the herds where BVDV and BoHV-1 are also present. These two viruses are endemic and covered by eradication programmes introduced in Poland. Different large-scale studies on BVDV herd-level seroprevalence estimated using bulk milk samples showed that 33% or 71% of herds were infected with the virus (10, 18). The present study has shown a comparable animal-level seroprevalence of over 50% and over 70% herd-level seroprevalence. It must be stated, however, that the validity of the correlation is circumscribed by the limited number of animals and herds included. The problems with BVDV control arise also from vaccination failure and widening of the genetic variability of field BVDV strains, especially since BVDV-2 infection has been confirmed in Poland (15).
The seroprevalence and the number of virus-infected animals was the lowest in the case of BoHV-1 at 39.5% and 1%, respectively. These are similar results to those of a previous study in which serum samples collected from Polish dairy farms in 2011 showed the true prevalence of BoHV-1 infection to be 49.3% (17).
Both BVDV and BoHV-1 are considered primary pathogens, as they can lead to serious, potentially lethal diseases in cattle even as single agents, while in the case of BCoV, primary pathogen status remains controversial (14). Nevertheless, coinfection with multiple viral agents has been described by Ridpath
This is also the first report to describe BCoV detection in Poland. Sequences of BCoV showed clustering predominantly with viral strains originating from European countries and isolated in the last two decades, including the most recent Polish BCoV strains from 2020. All isolates originated from the respiratory tract but their sequences were closely related to both enteric and respiratory strains, with no clear clustering involving infection type. This was in line with previous observations that viral tissue tropism seemed to be unrelated to the genetic sequence of a particular strain (9, 28).
In conclusion, our study showed that infections with BCoV were common in the regions of Poland analysed in this study and were more seroprevalent than infections with BVDV and BoHV-1. Furthermore, statistical analysis showed that they may be associated with cases of respiratory disease in Polish cattle and may vary in frequency of occurrence by herd size and cattle age group. The sequences of Polish BCoVs mainly clustered by geographical location of isolation rather than isolation date or pathology.