The
The first bovine enteric caliciviruses were described in the late seventies in Europe. After the first description, Jena-like (GIII.1) and Newbury2-like (GIII.2) noroviruses have been increasingly detected in cattle with enteric or respiratory diseases worldwide (8, 17, 21, 22). After full length genome analysis of Bo/Newbury1/76/UK and Bo/Nebraska/80/US strains, they are designated under a novel genus as
In Turkey, bovine noroviruses were detected in diarrhoeic calves for the first time in 2011. Among 70 stool samples collected from calves, 6/70 (8.5%) samples were found to be positive in the Marmara region of Turkey (23). In another survey study, 4/235 (1.7%) samples were found to be positive for bovine norovirus in 2016 (7). There is no report of neboviruses in Turkey other than one describing a newly detected virus, designated as Kirklareli virus which is distantly related to neboviruses and lagoviruses (1).
The aims of the study are to examine bovine norovirus (BoNoV) and nebovirus (BoNeV) in diarrhoeic calves in Turkey and to suggest a new RT-PCR assay for the detection of these viruses. We believe that this is also the first report of bovine nebovirus detected in Turkey.
Sampling area
Faecal samples were diluted 1:10 with 1 M phosphate buffered saline and centrifuged for 5 min at 5,000 rpm to remove large cellular debris. After the centrifugation, supernatants were submitted to a nucleic acid extraction procedure using a GF-1 Viral Nucleic Acid Extraction Kit (Vivantis Technologies, Malaysia) according to the manufacturer’s instructions. Eluted nucleic acids were stored at −80ºC until use.
Oligonucleotide data used in the study
Virus | Name | Sequence | Amplicon size (bp) | Location | Reference |
---|---|---|---|---|---|
Nebo2F | TYTAYGACGGGCGCTWTTATGG | ||||
Nebovirus | Nebo1R | AGACAGTGCCGAAAAGGGTGTA | 282 | 4984–5265a | This study |
BoNoV851-F | ATGTGGTVCAGGCNAACAGCTA | ||||
BoNoV1350-R | ACTACCTTCCCACARHGACARA | 500 | 4538–5037b | This study | |
Norovirus | IIIBovNo-F | CGCTCCATGTTYGCBTGG | |||
IIIBovNo-R | ATCAGCACATGRGGRAACTG | 516 | 4972–5487c | (13) |
PCR was conducted in a 50 μl final volume using 5 μL of the RT reaction mixture as a template. The PCR mixture contained 5 μL of 10× PCR buffer, 10 mM of dNTP, 10 pmol/μL of each set of sense/antisense primers, and 5 U of Taq DNA polymerase (Vivantis, Germany). PCR was conducted under the following conditions: 1 cycle at 95°C for 2 min; 40 cycles at 94°C for 40 s, 5°C below primer melting temperature for 30 s, and 72°C for 40 s; and a final elongation step at 72°C for 10 min. PCR products were analysed by electrophoresis in 2% agarose gels stained with ethidium bromide.
GenBank accession numbers of noro- and nebovirus strains used in genetic analysis
Genus | Strain | Accession number | Genotype |
---|---|---|---|
Mu/NoV/GV/MNV1/2002/USA | AY228235.2 | GV | |
NLV/SaintCloud/624/1998/US | AF414427.1 | GIV. 1 | |
NLV/Brattleboro/321/1995/US | AF414415.1 | GII.3 | |
Toronto/ CAN | U02030 | GII.3 | |
SOV/ UK | L07418 | GI.2 | |
NV/USA | M87661 | GI.1 | |
Bo/Thirsk10/00/UK | AY126468.2 | GIII. 1 | |
Bo/Jena/DE | AJ011099 | GIII. 1 | |
Bo/ DuzceN2/2010/TUR | KF218823.1 | GIII.2 | |
Bo/SivasN6/2011/TUR | KF218824.1 | GIII.2 | |
bovine/ DijonA077/06/FR | GU259577.1 | GIII.2 | |
bovine/ DijonA436/08/FR | GU259579.1 | GIII.2 | |
Bo/Newbury2/1976/UK | AF097917.5 | GIII.2 | |
Bo/NoV/JN-MA156/04/Korea | DQ912792.1 | GIII.2 | |
Bo/ Dumfries/94/UK | AY126474.2 | GIII.2 | |
Bo/AdiyamanN6/2011/TUR | KF218825.1 | GIII.2 | |
Bo/BalikesirN9/2009/TUR | KF218822.1 | GIII.2 | |
bovine/GIII.2/471_0790/2005/NOR | FM242193.1 | GIII.2 | |
bovine/GIII.2/718_0785/2006/NOR | FM242191.1 | GIII.2 | |
bovine/GIII.2/312_0529/2006/NOR | FM242186.1 | GIII.2 | |
bovine/GIII.2/240_0243/2005/NOR | FM242189.1 | GIII.2 | |
Bo/Nov-33/USA/2010 | JN585051.1 | GIII.2 | |
BoNoV/ Bolat7/2016/TR | MG022084 | GIII.2 | |
BoNoV/Bolat85/2016/TR | MG022085 | GIII.2 | |
Bo/Nov-45/USA/2010 | JN585060.1 | GIII.2 | |
Bo/Nov-6/USA/2010 | JN585033.1 | GIII.2 | |
Norovirus | Bo/Nov-16/USA/2010 | JN585041.1 | GIII.2 |
Bo/Nov-10/USA/2010 | JN585036.1 | GIII.2 | |
Bo/Nov-2/USA/2010 | JN585029.1 | GIII.2 | |
Bo/Nov-1/USA/2010 | JN585028.1 | GIII.2 | |
Bo/Nov-13/USA/2010 | JN585038.1 | GIII.2 | |
Bo/NoV/JN-MA140/04/Korea | DQ912791.1 | GIII.2 | |
Bo/NoV/JN-MA302/04/Korea | DQ912797.1 | GIII.2 | |
Bo/NoV/JN-MA271/04/Korea | DQ912795.1 | GIII.2 | |
Bo/NoV/JN-SA296/04/Korea | DQ912796.1 | GIII.2 | |
bovine/ DijonA407/08/FR | GU259575.1 | GIII.2 | |
Bo/MonastirB139/2009/TUN | JN418489.1 | GIII.2 | |
bovine/Belgium/B52/2002/Be | AY686489.2 | GIII.2 | |
bovine/XJSHZ148/2011/CN | JQ905268.1 | GIII.2 | |
BEC200/IT | HM745911.1 | GIII.2 | |
Bo/Penrith55/00/UK | AY126476.1 | GIII.2 | |
BEC830/IT | HM745913.1 | GIII.2 | |
Bovine/ Wasme/B200/2003/Be | AY686494.1 | GIII.2 | |
Bovine/Wasme/B199/2003/Be | AY686493.1 | GIII.2 | |
CV186-OH | AF542084.1 | GIII.2 | |
CV95-OH | AF542083.1 | GIII.2 | |
Bo/ 21Z90/GIII.2/2012/Iran | KM650007.1 | GIII.2 | |
BEC483/IT | HM745909.1 | GIII.2 | |
Bovine/ Mohiville/B 123/2002/Be | AY686490.2 | GIII.2 | |
Bo/4Z90/GIII.2/2012/Iran | KM650013.1 | GIII.2 | |
Bo/6P90/GIII.2/2011/Iran | KM650011.1 | GIII.2 | |
Bo/ 58B89/GIII.2/2010/Iran | KM650009.1 | GIII.2 | |
Bo/27T90/GIII.2/2011/Iran | KM650012.1 | GIII.2 | |
Bo/BEC/PenrithC39/2000/UK | DQ228162 | ||
Bo/M3641/2000/HUN | JX018212 | ||
bovine/ DijonA290-2/07/FR | GU259551 | ||
bovine/DijonA386/08/FR | GU259561 | ||
bovine/ DijonA364/08/FR | GU259556 | ||
Bo/Nebraska/80/US | AY082891 | ||
bovine/DijonA058/05/FR | GU259542 | ||
Bo/BEC/Penrith140/2000/UK | DQ228159 | ||
Bo/ BEC/Starcross93/2000/UK | DQ228165 | ||
Nebovirus | Bo/CV548-OH/2002/US | AY549172 | |
Bo/ CV531-OH/2002/US | AY549171 | ||
Bo/ CV526-OH/2002/US | AY549170 | ||
Bo/ CV504-OH/2002/US | AY549168 | ||
Bo/ CV562-OH/2002/US | AY549173 | ||
Bo/BEC/Starcross117/2000/UK | DQ228164 | ||
Bo/BEC/Penrith142/2000/UK | DQ228160 | ||
Bo/BEC/Penrith143/2000/UK | DQ228161 | ||
Bo/ BEC/Penrith 150/2000/UK | DQ228157 | ||
Bo/Newbury1/76/UK | NC_007916 | ||
Bo/ DijonA216/06/FR | FJ687386 | ||
BoNeV/ Sivas100/2016/TR | MG022086 | ||
BoNeV/ Sivas120/2016/TR | MG022087 | ||
BoNeV/ Sivas54/2016/TR | MG022088 | ||
BoNeV/ Sivas60/2016/TR | MG022089 | ||
BoNeV/ Sivas63/2016/TR | MG022090 | ||
BoNeV/ Sivas64/2016/TR | MG022091 | ||
BoNeV/ Sivas75/2016/TR | MG022092 |
Partial sequences indicated that NeV/Sivas60/ 2017/TR, NeV/Sivas63/2017/TR, and NeV/Sivas64/ 2017/TR strains clustered together with 99.82% identity, while four other strains were clustered in another branch. The NeSV/Sivas75/2017/TR strain showed the highest identity with NeV/Sivas100/2017/TR (99.82%), and next highest identity with NeV/ Sivas120/2017/TR strain (99.45%). NeV/Sivas54/2017/TR strain was located outside of the other six NeV strains (Fig. 2). The NeV/Sivas60/2017/TR, NeV/Sivas63/2017/TR, and NeV/Sivas64/2017/TR triplet were also closely related to a partial polyprotein gene of a Nebraska-like strain, PenrithC39/2000/UK (97.99%).
cladogram representing the phylogenic tree of bovine neboviruses based on 274 bp sequences. Each coloured branch indicates a different genotypes. Tree construction was built with use of Unipro UGENE v.1.21 software (14)
Two novel norovirus strains, Bo/NoV/Bolat7/ 2016/TR and Bo/NoV/Bolat85/2016/TR, were clustered together with 96.94% identity and merged with the Bo/Nov-6/USA/2010 and Bo/Nov-45/USA/2010 strains previously reported in the USA. Other related strains, Bo/Nov-1, -2, -10, -13 and -16, also intersected on the same root. On the other hand, comparison with reference strains implicated that these novel strains were in the GIII.2 genogroup (Fig. 3). Other norovirus members which were previously reported in Turkey were also matched in phylogenetic analysis. Bo/Balikesir/N9/ 2009/TUR showed the highest identity with the novel strains (90.80%) while Bo/SivasN6/2011/TUR showed 88.65%, Bo/DuzceN2/2010/TUR – 87.42%, and Bo/AdiyamanN6/2011/TUR – 86.81% identities.
Norovirus phylogenic tree constructed on 422 bp sequences. Alignment and classification of all genome data were performed by the UPGMA method with Unipro UGENE v. 1.21 software (14). Strains were coloured according to their genogroups. Novel norovirus sequences are shown as ruby red colour
In this study, the currency of two emerging pathogens related to bovine enteric caliciviruses has been evaluated. The pathogens emerged in the three Turkish provinces of Sivas, Malatya, and Elaziğ. We designed pairs of primers for each virus and used RT-PCR to survey the existing prevalence of these two viruses in diarrhoeic calves. As it is regarded as the “gold standard” for diagnosis, the RT-PCR-based molecular detection was preferred for faecal samples (19).
Bovine Norovirus GIII.2 genogroup is the most widespread genogroup globally (4). Several countries from Europe have reported the prevalence of BoNoV for both diarrhoeic and clinically healthy calves. For instance, in the Netherlands 31.69% (77/243) of randomly selected 1–52-week-old veal calves were found to be positive. On the other hand, 300 stool samples from diarrhoeic calves collected in Belgium indicated 9.33% positivity while 11% of 398 samples were positive in the UK (11, 13). In Ohio state in the USA, 72% positivity was found in randomly selected animals (21). A similar study was conducted in a neighbouring state, Michigan, and 80% prevalence was reported from diarrhoeic samples (22). Several countries also reported that BoNoV could significantly affect calves. In South Korea 9.3% prevalence was found in 645 diarrhoeic faecal samples while in Argentina the prevalence was 3.3% in 90 samples, in Tunisia the prevalence was 16.6% in 169 samples, and in Egypt it was 24% in 25 samples (6, 8, 14, 17).
In Turkey, the first detection of BoNoV was reported in 2011. In this study faecal samples were collected from diarrhoeic calves in the Marmara region of Turkey and prevalence was detected at the rate of 8.57% (24). Later, a retrospective survey was conducted on 235 samples collected between 2009 and 2011 in Turkey and the prevelance rate was 1.57% (7). In this study the prevalence was determined as 3.93% in three provinces located in the Central-Eastern Anatolia, Turkey. This rate appears to be in agreement with previous reports in Turkey and other countries such as Argentina. In contrast, it is lower than in several countries, for instance the USA, the UK, South Korea, and Belgium. Distribution of noroviruses appears to be variable. Also animal age, sampling, and diagnostic methods may affect findings (19).
Nebovirus genus forms a different clade and includes three known genotypes of strains: Nebraska (NB), Newbury (NA1), and the recently suggested DijonA216 (9, 16). Phylogenetic studies indicate that these genotypes have 98% similarity based on their capsid protein sequences (16). We reported seven novel strains being clustered with the Nebraska-like genotypes. This is the first detection of neboviruses in Turkey.
The prevalence of nebovirus has been reported in several countries. For example, in France the prevalence rate was reported at 7% in diarrhoeic cattle (9) while the statistic was 8.4% in the UK (22), 9.2% in South Korea (17), 4.8% in Brazil (2), and 3.3% in Tunisia (8). On the other hand, Smiley
Non-haemorrhagic enteritis and mild diarrhoea are clinically observable signs in calves infected with BoNoV and BoNeVs. NoV Newbury Agent 2 shows less virulence than Newbury Agent 1 which is known as
In summary, bovine norovirus (3.93%) and nebovirus (25.19%) were detected in diarrhoeic calves from three cities of Central Anatolia, Turkey. Phylogenic analysis of noroviruses showed that all of the novel sequences classified into the Norovirus GIII.2 genogroup. All novel neboviruses were grouped together with Nebraska-like strains as well. Nebovirus was also detected with relatively high incidence. The distribution of BoNeV has only been reported in a number of countries. On the other hand, in the literature bovine noroviruses were predominantly detected as compared to neboviruses. Interestingly, bovine neboviruses found to be more prevalent in the studied area. We suggest that bovine neboviruses are more often the cause of calf diarrhoea than is supposed by virologists.