Uneingeschränkter Zugang

Complete genome sequences of three sub-genotype 2.1b isolates of classical swine fever virus in China

Chunxiao Liu
Chunxiao Liu
, 
Mingliang Li
Mingliang Li
, 
Xingwang Yin
Xingwang Yin
, 
Hongliang Zhang
Hongliang Zhang
, 
Lirun Xiang
Lirun Xiang
, 
Hongyue Zhai
Hongyue Zhai
, 
Congcong Wang
Congcong Wang
, 
Yunchao Kan
Yunchao Kan
, 
Lunguang Yao
Lunguang Yao
, 
Zhijun Tian
Zhijun Tian
 und 
Chaoliang Leng
Chaoliang Leng
   | 30. März 2018
Journal of Veterinary Research's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
Online veröffentlicht: 30. März 2018
Seitenbereich: 7 - 15
Eingereicht: 22. Okt. 2017
Akzeptiert: 15. März 2018
DOI: https://doi.org/10.2478/jvetres-2018-0002
Schlüsselwörter
© 2018 C. Liu et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Phylogenetic analysis of the 3 new isolates (•) and other reference CSFV isolates based on the complete genomic sequences (A) and full-length E2 gene sequences (B)
Phylogenetic analysis of the 3 new isolates (•) and other reference CSFV isolates based on the complete genomic sequences (A) and full-length E2 gene sequences (B)

Fig. 2

Sequence alignments of 5′UTR of the 3 new CSFV isolates and 32 reference isolates. Some mutation or deletion regions of these isolates are indicated by red boxes (□) and described in detail in the text
Sequence alignments of 5′UTR of the 3 new CSFV isolates and 32 reference isolates. Some mutation or deletion regions of these isolates are indicated by red boxes (□) and described in detail in the text

Fig. 3

Sequence alignments of 3′UTR of the 3 new CSFV isolates and 11 reference isolates. Some mutation or insertion regions of these isolates are indicated by red boxes (□) and described in detail in the text
Sequence alignments of 3′UTR of the 3 new CSFV isolates and 11 reference isolates. Some mutation or insertion regions of these isolates are indicated by red boxes (□) and described in detail in the text

Fig. 4

Amino acid sequence alignments of E2 genes of the 3 new CSFV isolates and 33 reference isolates. The special mutation positions of these isolates are indicated by red boxes (□) and described in detail in the text
Amino acid sequence alignments of E2 genes of the 3 new CSFV isolates and 33 reference isolates. The special mutation positions of these isolates are indicated by red boxes (□) and described in detail in the text

The genome homology of SD2014-1, SD2014-2, and SD2014-3 (%)

Strains SD2014-1 SD2014-2 SD2014-3
SD2014-1 – 97.7 98.6
SD2014-2 97.7 – 97.9
SD2014-3 98.6 97.9 –

Detailed comparison of the full-length genomes of SD2014-1, SD2014-2, and SD2014-3 to other representative CSFV isolates (%)

Nucleotides Shimen (1.1)a Paderborn (2.1a)a HEBZ (2.1b)a HNSD-2012 (2.1c)a JSZL (2.1d)a CSFV39 (2.2)a Alfort/ Tuebingen (2.3)a 94.4/IL/94/T-WN (3.4)a
5′UTR 94.1∗ 97.1∗ 98.1∗ 96.2∗ 96.8∗ 94.4∗ 94.6∗ 91.4∗
92.8∗∗ 98.1∗∗ 96.8∗∗ 96.5∗∗ 97.1∗∗ 93.0∗∗ 95.4∗∗ 92.8∗∗
93.3∗∗∗ 97.6∗∗∗ 97.3∗∗∗ 96.0∗∗∗ 97.6∗∗∗ 93.8∗∗∗ 94.1∗∗∗ 92.2∗∗∗
Npro 87.1 94.2 95.6 92.9 95.6 87.5 87.9 85.3
86.9 93.3 94.6 92.1 94.6 87.3 87.5 84.3
86.9 94.0 95.4 93.1 95.8 88.1 88.5 85.1
C 84.2 94.6 93.6 90.6 95.6 89.2 90.9 84.2
83.8 94.9 93.3 90.9 95.3 89.6 91.2 83.8
84.2 94.3 92.6 90.2 94.6 88.9 90.6 84.5
Erns 84.1 93.0 94.3 92.7 95.0 89.3 90.3 83.1
84.7 92.5 94.0 92.5 94.9 89.0 90.0 83.4
84.1 92.5 93.8 92.8 94.6 88.8 90.2 83.7
E1 85.3 93.5 94.5 91.1 94.7 89.1 88.9 81.0
85.3 93.8 95.2 91.5 95.4 90.8 88.9 81.9
85.1 94.0 94.7 91.6 95.2 89.9 89.4 81.7
E2 83.3 93.7 93.9 90.2 93.7 87.7 87.8 81.5
83.6 93.7 94.3 90.2 93.7 87.9 87.9 81.9
83.6 93.8 94.1 90.3 93.7 87.7 88.0 81.4
P7 79.2 95.2 96.6 94.2 93.7 89.9 89.9 86.0
81.2 95.2 96.1 94.2 94.2 89.9 89.4 87.0
80.2 95.2 96.1 94.2 93.2 89.9 89.4 87.0
NS2 82.8 92.7 94.5 91.1 93.8 88.3 88.0 80.4
82.5 93.1 94.7 91.2 93.4 88.0 88.4 80.1
82.9 93.0 94.7 91.5 93.8 88.4 88.3 80.2
NS3 86.9 94.9 95.2 93.4 95.5 90.7 90.9 85.8
86.5 94.7 94.9 93.2 95.3 90.6 90.6 85.2
97.0 95.1 95.2 93.3 95.7 90.8 91.2 85.4
NS4A 87.8 96.3 95.2 91.0 95.8 90.5 91.5 83.1
87.3 95.2 94.2 92.1 94.7 88.4 88.4 85.2
89.4 95.8 94.7 91.5 95.2 89.9 91.0 83.6
NS4B 87.8 93.1 94.6 91.0 94.1 90.0 88.8 84.2
88.0 93.7 95.0 91.9 95.1 90.6 89.2 85.0
88.1 93.8 95.3 91.6 94.6 89.9 89.3 84.6
NS5A 85.2 93.2 94.4 91.0 93.6 85.2 90.1 82.3
85.5 93.4 94.7 90.9 93.8 85.4 90.1 82.4
85.5 93.4 94.7 90.8 94.0 85.3 90.0 82.5
NS5B 85.0 94.2 95.0 92.5 94.9 85.4 90.1 83.2
85.1 94.7 95.6 92.7 95.2 85.6 90.4 83.6
85.0 94.8 95.6 93.2 95.3 85.4 90.4 83.4
3′UTR 85.9 95.7 95.3 93.4 96.1 85.5 95.3 81.9
85.0 94.8 94.4 93.4 96.1 84.6 94.4 81.9
84.1 93.5 93.1 93.4 94.8 83.7 93.1 81.1
Complete 85.5 94.0 94.9 92.0 94.7 88.2 89.8 83.4
85.5 94.1 94.9 92.1 94.7 88.3 89.8 83.6
85.5 94.2 95.0 92.3 94.8 88.2 90.0 83.5
Amino acid
Npro 92.9 97.0 95.2 95.8 96.4 93.5 90.5 91.7
93.5 96.4 94.6 95.2 95.8 92.9 91.1 91.1
92.9 97.0 95.2 95.8 96.4 93.5 91.7 91.7
C 91.9 94.9 97.0 92.9 97.0 93.9 92.9 88.9
90.9 94.9 94.9 92.9 94.9 93.9 92.9 88.9
90.9 94.9 94.9 92.9 94.9 93.9 92.9 88.9
Erns 89.9 97.4 97.8 98.2 98.2 95.2 96.0 91.2
89.9 97.4 97.8 98.2 98.2 95.2 96.0 91.2
89.9 96.5 96.9 97.4 97.4 94.3 95.2 91.2
El 92.3 96.4 95.9 94.9 96.4 96.4 96.4 89.2
93.8 97.4 96.9 95.9 97.4 97.4 97.4 90.8
93.8 97.4 96.9 95.9 97.4 97.4 97.4 90.8
E2 88.5 95.2 95.7 94.6 95.7 90.1 92.2 88.2
89.8 96.0 95.7 95.4 95.7 91.4 93.2 89.0
89.5 96.0 96.5 95.7 96.5 90.9 93.0 89.0
P7 91.3 98.6 95.7 97.1 94.2 95.7 95.7 95.7
92.8 98.6 95.7 97.1 94.2 95.7 95.7 94.2
91.3 98.6 95.7 97.1 94.2 95.7 95.7 95.7
NS2 90.6 97.6 97.2 96.9 96.1 95.4 94.7 88.0
90.8 97.8 97.4 96.7 95.8 95.4 95.0 88.2
90.6 97.4 97.4 96.7 95.8 95.4 95.0 88.2
NS3 98.4 99.4 98.8 98.8 99.4 98.7 99.1 98.5
98.1 99.1 98.5 98.5 99.1 98.4 98.8 98.2
98.4 99.4 98.8 98.8 99.4 98.7 99.1 98.5
NS4A 98.4 100 98.4 95.2 100 96.8 100 95.2
98.4 100 98.4 95.2 100 96.8 100 95.2
98.4 100 98.4 95.2 100 96.8 100 95.2
NS4B 96.0 98.3 98.8 99.1 98.6 96.8 98.3 93.9
96.0 98.3 98.8 99.1 98.6 96.8 98.3 93.9
95.7 98.0 98.6 98.8 98.3 96.5 98.0 93.7
NS5A 88.6 95.0 95.4 93.2 95.2 88.2 93.4 86.9
89.2 95.2 95.6 93.4 95.2 88.8 93.2 87.3
88.8 95.0 95.4 93.2 95.6 88.4 93.0 86.7
NS5B 91.8 96.5 96.6 96.4 97.5 92.5 95.8 89.4
91.9 97.1 97.6 97.2 98.5 92.6 95.9 89.4
92.6 97.8 97.9 97.6 98.7 93.3 96.6 90.1

Primers used for amplification of gene fragments of CSFV SD2014-1, SD2014-2, and SD2014-3

Fragment Primer sequence (5′-3′)

The primer sequence, position in genome and product size with respect to the CSFV Zj0801 (accession no. FJ529205) genome

 Position in genome

The primer sequence, position in genome and product size with respect to the CSFV Zj0801 (accession no. FJ529205) genome

 Product size (bp)

The primer sequence, position in genome and product size with respect to the CSFV Zj0801 (accession no. FJ529205) genome
CSFV-A GTATACGAGGTTAGTTCATTCTCGT 1–2,047 2,047
GATTACCAGAGAAAGCAACAAGAAT
CSFV-B GATAATAGGCCCCGGTAAATTTGAC 2,023–3,313 1,291
TTTCCTTACAGGTCCCTCGCTAGAG
CSFV-C AAATGAGACGGGTTACAGGGTA 3,124–4,771 1,648
CATCCCGTAGATCTCTTCACCTCCA
CSFV-D CATAGATGAAATAGCTGGCGGGACC 4,564–7,171 2,608
TAGTGCTCTGCCAGCCTCCACAGTG
CSFV-E TCTGCTGATATCAGAGGAGCTG 6,866–668 2,803
GCTTACCCAGACTTAATGTTTCTAG
CSFV-F GCCCTATGTAAGGTCGACACCGCTC 9,572–12,296 2,725
GGGCCGTTAGGAAATTACCTTAGTC
eISSN:
2450-8608
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Molekularbiologie, Mikrobiologie und Virologie, andere, Medizin, Veterinärmedizin
Zeitschrift RSS Feed