Uneingeschränkter Zugang

Ex vitro Rooting, Acclimatization and Genetic Stability of Lonicera caerulea var. kamtschatica


Zitieren

INTRODUCTION

Blue honeysuckle (Lonicera caerulea L. var. kamtschatica Sevast.) belongs to the family Caprifoliaceae, genus Lonicera, which includes about 200 species (Poyarkova 2000). It has been growing wild in Siberia for millennia and was treasured for its nutritional value. Nowadays, it is cultivated across Japan, China, Russia, Central and Eastern Europe, especially Poland, the Czech Republic, Slovenia, Slovakia, and North America, Canada and the USA. Blue honeysuckle, also called “sweet berry honeysuckle”, “haskap berry” or “edible honeysuckle”, is a shrub that grows up to 2 m. It is a long-lived plant and can bear fruit up to 30 years. In addition, it is resistant to diseases, pests and frost. The fruits are rich in bioactive compounds, polyphenols, especially anthocyanins, and exhibit anti-inflammatory and bacteriostatic properties (Plekhanova 2000; Svarcova et al. 2007; Jurikova et al. 2011). The fruits can be sold as fresh or frozen products or used for juices, jams or even wine and gin products. An improved understanding of the role of dietary value of fruit in maintaining human health caused a noticeable increase of interest in the cultivation of this plant. In December 13, 2018 under regulation no. 2015/2283 of the European Parliament, fruits of L. caerulea L. were entered on the list of novel foods. This gave the opportunity to legally market blue honeysuckle berries in the European Union.

Honeysuckle species are propagated traditionally by semi-hardwood and softwood cuttings. This method, though generally successful, largely depends on the individual genotype, age of the stock plant and vegetation period (Hui et al. 2012). Tissue culture offers an alternative method of plant propagation, which is independent of the vegetative season. High multiplication rates and good health status of micropropagated plants are the additional features of this method. Most of the studies on in vitro culture of blue honeysuckle involved micropropagation by axillary shoots in the presence of 6-benzylaminopurine (BAP) (Karhu 1997a; Sedlák & Paprštein 2007; Dziedzic 2008; Krupa-Małkiewicz & Ochmian 2014) or the mixture of 2-isopentyladenine (2iP) and 3-hydroxybenzyladenine (meta-topolin) (Gabryszewska et al. 2016). In vitro rooting of shoots has been successfully achieved by using auxin treatment (Karhu 1997b; Dziedzic 2008; Krupa-Małkiewicz et al. 2017). On an auxin-free medium, the rooting rate was low, for example, 4–8% for ‘Wojtek’ and 40% for ‘Zojka’, and a weak root system has been observed (Krupa-Małkiewicz et al. 2017, Wojtania et al. 2018). There is so far no information on ex vitro rooting and acclimatization of blue honeysuckle microshoots. The success of micropropagation is clearly dependent on acclimatization of plantlets to the ex vitro condition and maintaining the genetic stability of propagules.

Under long-term in vitro propagation, various factors such as genotype, explant type and origin, media composition, plant growth regulators and cultural environment may induce the variation in plant material (Podwyszyńska 2006; Olhoft & Phillips 1999; Bednarek & Orłowska 2020). Various types of phenotypic and genetic changes have been observed including polyploidy, aneuploidy and other types of mutations such as, e.g., point mutations or insertions of transposons but also changes resulting from, for example, DNA methylation or histone modifications. These modifications may influence gene transcription. Epigenetic changes are often temporary, and plants may revert to the normal phenotype relatively easily (Jain 2001; Smulders & de Klerk 2011). Molecular markers become the most desirable tool for establishing genetic uniformity of in vitro derived plantlets of different plant species, including berry plants such as lowbush blueberry, strawberry and blackberry (Debnath 2011, 2013; Borsai et al. 2020). To date, there is no genetic stability assessment system for micropropagated plants of blue honeysuckle.

The aim of this study was to develop an effective method of ex vitro rooting and acclimatization of micro-cutting of two L. caerulea var. kamtschatica cultivars ‘Wojtek’ and ‘Zojka’. The genetic stability of plantlets in relation to the mother plants by using amplified fragment length polymorphism (AFLP) and inter simple sequence repeat (ISSR) markers has been also determined.

MATERIALS AND METHODS
Plant material

Axillary shoot cultures of two L. caerulea var. kamtschatica cultivars ‘Wojtek’ and ‘Zojka’ were initiated from 2-year-old nursery plants. Shoots were established and continuously multiplied for 2 years on the Murashige and Skoog (1962) medium (MS) modified with a supplementation 85.5 mg·dm−3 NaH2PO4·H2O, 100 mg·dm−3 myoinositol, nicotinic acid, pyridoxine and thiamine (1.0 mg·dm−3 each), 15 mg·dm−3 2iP, 1.0 mg·dm−3meta-topolin, 30 g·dm−3 sucrose and solidified with a mixture of gelling agents, 3 g·dm−3 agar (Biocorp, Poland) and 1.2 g·dm−3 Gelrite (Duchefa, Netherlands) (Gabryszewska et al. 2016). The pH of the medium was adjusted to 5.6 before autoclaving. Axillary shoot cultures were subcultured on the fresh medium every 6–8 weeks.

Acclimatization of in vitro rooted shoots (Experiment 1)

The shoots were rooted in vitro on the MS medium containing indole-3-butyric acid (IBA) or 1-naphthaleneacetic acid (IAA) at different concentrations (0.0; 1.0; 2.5; and 4.0 mg·dm−3) (Wojtania et al. 2018). The aim of this experiment was to determine the post-effect of auxin type and concentrations on ex vitro acclimatization. The in vitro rooted microcuttings were planted at the end of March in multi-cell plug trays of 30 mm diameter, with peat substrate, in plastic mini-greenhouses (Garland Products, UK) with two adjustable “dial” ventilators to control the humidity and optimize growing conditions. The plants were maintained for 4 weeks in a growth room under fluorescent lamps (50 μmol·m−2·s−1) at 23 ± 2 °C. Starting with day 7 after the transfer to ex vitro conditions, the humidity was stepwise reduced by opening the ventilators and the plantlets were fertilized with Peters Professional Plant Starter (0.25 g·dm−3). After 6 weeks, the following data were collected: survival rate, fresh mass and length of cuttings as well as fresh mass, the number and length of roots.

Ex vitro direct rooting and acclimatization (Experiment 2)

The aim of this experiment was to determine ex vitro rooting and acclimatization ability in the greenhouse of axillary shoots derived from a 6-week-old in vitro cultures incubated on a multiplication medium. For ex vitro direct rooting, two types of explants were used: single microshoots about 1.0 cm long and clumps of 4–5 shoots. The experiment started in mid-June. Both explant types were planted in multi cell plug trays of 30 mm diameter with three different soil substrates – peat, peat + sand (2 : 1 v/v), peat + perlite (2 : 1) – in plastic mini-greenhouses maintained in the greenhouse. Cuttings were maintained under natural photoperiod and irradiance with day/night of 24 ± 5 °C/18 ± 5 °C. The acclimatization procedure was the same as in Experiment 1. After 6 weeks of growing ex vitro in the greenhouse, the following data were collected: survival and rooting rate, fresh mass and length of cutting as well as fresh mass, the number and length of roots.

Genetic stability assessment

The genetic stability of acclimatized plantlets of two L. caerulea var. kamtschatica cultivars (‘Wojtek’ and ‘Zojka’) was evaluated in relation to the mother plants (standards) by using ISSR and AFLP analyses.

DNA was extracted from fresh leaves collected from 15 randomly selected acclimatized microplants of each cultivar. Genomic DNA was extracted using the Gene MATRIX Plant & Fungi DNA Purification Kit (EURx) in two replicates for each sample tested. The concentration and purity of the DNA were determined using an Epoch spectrophotometer (BioTek). Four ISSR and four AFLP primer pairs were finally used in the study after an initial screening of 23 ISSR and 23 AFLP primer pairs for the production of a high number of distinct and countable bands (Tab. 1). For ISSR analysis, the PCR reaction was carried out in 20 μL reaction volume containing 20 ng DNA, 1 × DreamTaq™ Green Buffer (Thermo Fisher Scientific), 0.65 μL dNTPs (10 mM) (Promega), 0.45 μL ISSR primer (10 μM) and 0.5 U DreamTaq™ Green Polymerase (Thermo Fisher Scientific). Amplification was carried out in the T100 Thermal Cycler (BioRad) programmed for 45 ISSR cycles (30 s at 94 °C, 40 s at 55 °C, 90 s at 72 °C). All reactions were repeated twice. The PCR products obtained were separated on 1.5% agarose gel through electrophoresis and photographed using Syngen Biotech camera. The size of the bands was assessed against size standards Gene-Ruler™ 100 bp DNA Ladder Plus (Thermo Fisher Scientific). For AFLP analysis, genomic DNA (50 ng) was digested with MseI and PstI endonucleases and ligated with appropriate adapters (Vos et al. 1995). Preamplification of obtained fragments was carried out using primers complementary to the adapter's sequence. The preselection PCR reaction mixture contains 20 μL DNA, 1 × Taq Polymerase Reaction Buffer (Sigma-Aldrich), 0.8 μL dNTPs (10 mM) (Promega), 1.2 μL of each primer (10 μM) and 0.75 U Taq DNA Polymerase (Sigma-Aldrich). Amplifications were carried out in the thermal cycler programmed for 30 cycles (30 s at 94 °C, 30 s at 60 °C, 60 s at 72 °C). The selective PCR with primer pairs was obtained by extending the primers used in preamplification with two additional nucleotides at the 3’ end (Tab. 1). PCR was carried out in the reaction mixture containing 3 μL DNA 1 : 30 (v : v), 1 × Taq Polymerase Reaction Buffer (Sigma-Aldrich), 0.4 μL dNTPs (10 mM) (Promega), 0.5 μL PstI-NN primer (10 μM), 0.65 μL MseI-NN primer (10 μM) and 0.75 U Taq DNA Polymerase (Sigma-Aldrich). Amplification was carried out in the thermal cycler programmed for 13 cycles (30 s at 94 °C, 30 s at 65–56 °C with annealing temperature decreased by 0.7 °C in each cycle, 60 s at 72 °C), followed by 26 cycles (30 s at 94 °C, 30 s at 56 °C, 60 s at 72 °C). Products of selective PCR were separated on 6% denaturing polyacrylamide gel through electrophoresis on Dual Dedicated Height Nucleic Acid Sequencer (C.B.S. Scientific). The separated AFLP products were stained in a silver nitrate solution and the gel was dried, described and photographed. The size of the bands was assessed against size standards 10 bp DNA Ladder (Invitrogen) and 50 bp DNA Ladder (Invitrogen). Bands generated in ISSR and AFLP analysis were scored manually as present (1) or absent (0) from the photographs. Only bright and reproducible products were scored. During the analysis of electrophoregrams, the number of ISSR and AFLP products, their size and diversity between mother plants and plants obtained from micropropagation were evaluated.

Primers, polymorphism between tested cultivars and amplification products of ISSR-PCR and AFLPPCR used for evaluation of genetic identity of Lonicera caerulea ‘Wojtek’ and ‘Zojka’ plants

No.PrimerSequence (5′–3′)Total number of bandsPolymorphic bands (%)PrimerSequence (5′–3′)Total number of bandsPolymorphic bands (%)
ISSRAFLP
1UBC 806(TA)8G--Pst-TT/Mse-CC*GACTGCGTACATGCAGTTGATGAGTCCTGAGTAACC3013.3
2UBC 810*(GA)8T616.7Pst-GC/Mse-GCGACTGCGTACATGCAGGCGATGAGTCCTGAGTAAGC210
3UBC 813(CT)8T--Pst-GC/Mse-TA*GACTGCGTACATGCAGGCGATGAGTCCTGAGTAATA1811.1
4UBC 821(GT)8T--Pst-TA/Mse-TAGACTGCGTACATGCAGTAGATGAGTCCTGAGTAATA140
5UBC 822(TC)8A90Pst-TA/Mse-GCGACTGCGTACATGCAGTAGATGAGTCCTGAGTAAGC420
6UBC 823(TC)8C50Pst-AG/Mse-AGGACTGCGTACATGCAGAGGATGAGTCCTGAGTAAAG540
7UBC 825*(AC)8T728.6Pst-AG/Mse-CGGACTGCGTACATGCAGAGGATGAGTCCTGAGTAACG360
8UBC 827*(AC)8G128.3Pst-CG/Mse-AG*GACTGCGTACATGCAGCGGATGAGTCCTGAGTAAAG424.8
9UBC 828(TG)8A20Pst-TC/Mse-TCGACTGCGTACATGCAGTCGATGAGTCCTGAGTAATC130
10UBC 830(TG)8G10Pst-TC/Mse-ATGACTGCGTACATGCAGTCGATGAGTCCTGAGTAAAT200
11UBC 834(AG)8CT30Pst-AT/Mse-ATGACTGCGTACATGCAGATGATGAGTCCTGAGTAAAT500
12UBC 840(GA)8CT20Pst-AT/Mse-TCGACTGCGTACATGCAGATGATGAGTCCTGAGTAATC250
13UBC 843(CT)8GA10Pst-AA/Mse-AAGACTGCGTACATGCAGAAGATGAGTCCTGAGTAAAA130
14UBC 846(CA)8GT30Pst-AA/Mse-ACGACTGCGTACATGCAGAAGATGAGTCCTGAGTAAAC370
15UBC 853(TC)8AT60Pst-AC/Mse-ACGACTGCGTACATGCAGACGATGAGTCCTGAGTAAAC120
16UBC 848(CA)8GG--Pst-AC/Mse-AAGACTGCGTACATGCAGACGATGAGTCCTGAGTAAAA80
17UBC 849(GT)8CA--Pst-GG/Mse-GGGACTGCGTACATGCAGGGGATGAGTCCTGAGTAAGG--
18UBC 855(AC)8CT40Pst-GG/Mse-GAGACTGCGTACATGCAGGGGATGAGTCCTGAGTAAGA--
19UBC 858(TG)8AT--Pst-GA/Mse-GAGACTGCGTACATGCAGGAGATGAGTCCTGAGTAAGA190
20UBC 865*(CCG)6425.0Pst-GA/Mse-GCGACTGCGTACATGCAGGAGATGAGTCCTGAGTAAGC90
21UBC 867(GGC)6--Pst-CC/Mse-CC*GACTGCGTACATGCAGCCGATGAGTCCTGAGTAACC2030.0
22UBC 875(CTAG)4--Pst-CC/Mse-GGGACTGCGTACATGCAGCCGATGAGTCCTGAGTAAGG430
23UBC 881(GGGT)3G--Pst-TT/Mse-CCGACTGCGTACATGCAGTTGATGAGTCCTGAGTAACC480

primers selected for analysis of genetic stability of micropropagated plants;

“-” no visible and scorable bands

Statistical analysis

In all experiments on the rooting and acclimatization, 25 microcuttings for each treatment were taken. The experiments were carried out twice. The results were statistically analyzed with the use of the STATISTICA program (13.1 PL 2012, Statsoft, Poland). An analysis of variance was performed with ANOVA, R.A. Fischer for a two-factor system. Means were compared using Duncan's test at p = 0.05.

RESULTS
Acclimatization of in vitro rooted shoots

For both cultivars, the highest survival rate (max. 88%) was observed for microcuttings rooted on the medium containing the lowest auxin level (1.0 mg·dm−3). However, the differences between auxin type and concentration on survival rate in ex vitro conditions were not significant. It has been also found that the microcuttings rooted on low auxin medium after transfer to ex vitro conditions showed higher fresh mass and length of shoots as well as all root parameters (fresh mass, number and length) as compared to those rooted on the medium with high auxin (Tab. 2). During acclimatization, wilting and shoot tip necrosis were also observed, and these were most frequent among shoots rooted in vitro in the presence of high auxin concentration (data not shown).

The post-effect of auxin type (IAA and IBA) and concentration (0.0; 1.0; 2.5; 4.0 mg·dm−3) on ex vitro acclimatization of Lonicera caerulea ‘Zojka’ and ‘Wojtek’ in the growth chamber

GenotypeAuxin type/concentration (mg·dm−3)Survived micro-cutting (%)Fresh mass of shoots (mg)Shoot length (mm)Fresh root mass (mg)Root number/cuttingRoot length (mm)
‘Zojka’IBA0.084 a184 ± 46.9bc115 ± 11.0bc52.6 ± 20.7c2.5 ± 0.9c38.5 ± 9.8ab
1.088 a247 ± 69.7a154 ± 21.7a72.2 ± 35.0b3.7 ± 1.0ab37.1 ± 10.7ab
2.580 a174 ± 68.8bc126 ± 11.3b63.6 ± 23.4bc3.8 ± 0.7a32.4 ± 15.8bc
4.076 a179 ± 63.5bc116 ± 17.4bc54.8 ± 11.9bc3.7 ± 1.0ab28.7 ± 7.3c
IAA1.080 a219 ± 77.4ab111 ± 16.3c89.0 ± 36.7a3.5 ± 1.1ab42.0 ± 14.0a
2.576 a160 ± 67.9c117 ± 15.0bc48.4 ± 14.9 c3.3 ± 0.9ab36.2 ± 11.4a-c
4.072 a142 ± 67.1c114 ± 22.6bc52.6 ± 28.7c3.1 ± 0.9bc33.1 ± 7.1bc
‘Wojtek’IBA0.080 a218 ± 85.1b126 ± 32.4b42.7 ± 20.4 d2.5 ± 0.7d51.3 ± 8.5b
1.088 a349 ± 95.4a181 ± 23.1a120.1 ± 43.5a3.7 ± 1.1ab44.3 ± 7.8bc
2.584 a198 ± 73.8b135 ± 29.7b75.6 ± 22.4bc3.6 ± 0.9ab37.1 ± 8.8cd
4.068 a160 ± 81.5b124 ± 38.5b74.8 ± 25.7bc3.2 ± 0.7 b-d33.3 ± 8.5d
IAA1.084 a339 ± 50.3a146 ± 32.4b86.3 ± 34.7b4.1 ± 1.2a59.0 ± 18.9a
2.576 a210 ± 61.1b145 ± 17.2b70.8 ± 26.4bc3.4 ± 1.1bc30.5 ± 6.8d
4.076 a216 ± 58.4b140 ± 39.0b58.5 ± 21.8cd2.9 ± 1.0cd42.4 ± 14.7c

Means in the columns followed by the same letters do not differ significantly according to Duncan's multiple range test at p = 0.05; the assessment of significance of differences was done for each genotype separately; means ± SD

Ex vitro rooting and acclimatization

The results showed successful ex vitro rooting without auxin in the greenhouse of both blue honeysuckle cultivars (Tab. 3). The ability to form roots depended on genotype. Higher ex vitro rooting and survival rate in the greenhouse were observed for ‘Wojtek’ (max. 96%) than ‘Zojka’ (max. 88%). There were no significant differences in rooting/survival rate of ‘Zojka’ either between microcutting types or soil substrates. However, the plantlets of ‘Wojtek’ showed a higher rooting/survival rate when using individual microcuttings than shoot clumps (Fig. 1). Shoot clumps had a higher tendency toward the wilting and the shoot tip necrosis, leading to the death of some plantlets. The plants of both cultivars that were acclimatized in peat alone or in a mixture of peat and perlite exhibited higher mass of shoots and roots as well as length of shoots as compared to those grown in a mixture of peat and sand (Tab. 3). The micro-propagated plantlets appeared similar to mother plants.

Figure 1

Plantlets of blue honeysuckle growing in the greenhouse: A – ex vitro rooted shoots of ‘Wojtek’ after 6 weeks of growth on the peat; B – ex vitro rooted shoots of ‘Wojtek’ after 6 weeks of growth on the peat and perlite; C – plants of ‘Wojtek’ and ‘Zojka’ after 2 years of growth ex vitro

The effect of microcutting type and soil substrate type on ex vitro rooting and acclimatization of Lonicera caerulea ‘Zojka’ and ‘Wojtek’ in the greenhouse

Cutting typeSoil substrateRooted/survived plants (%)Fresh mass of shoots (mg)Shoot length (mm)Fresh root mass (mg)Root number/cuttingRoot length (mm)
‘Zojka’
Individual shootspeat88 a91.9 ± 20.0c81.4 ± 7.0a22.0 ± 8.7 c2.8 ± 1.1a25.6 ± 5.6a
peat + sand80 a52.9 ± 9.0d62.3 ± 8.0c11.0 ± 3.6d2.7 ± 0.7a24.4 ± 5.8a
peat + perlite84 a62.0 ± 17.0cd69.0 ± 14.0bc15.4 ± 8.3cd2.5 ± 0.7a23.7 ± 7.1a
Multiplied clumpspeat68 a127.7 ± 41.0b68.4 ± 14.0bc22.8 ± 8.7 c1.8 ± 0.5b12.0 ± 1.9b
peat + sand72 a139.3 ± 75.0ab50.3 ± 12.0d33.0 ± 21.3b2.9 ± 1.5a15.3 ± 6.5b
peat + perlite84 a164.2 ± 88.0a73.6 ± 22.9ab49.6 ± 24.4a3.0 ± 0.7a21.8 ± 7.5a
‘Wojtek’
Individual shootspeat96 a97.8 ± 20.0bc106.8 ± 14.9a20.9 ± 6.6c2.4 ± 0.7b27.1 ± 7.4a
peat + sand80 ab72.4 ± 20.0c85.8 ± 15.0b12.9 ± 6.9c1.9 ± 0.4c29.4 ± 8.1a
peat + perlite88 a114.2 ± 54.0bc112.3 ± 29.0a24.0 ± 9.5bc1.9 ± 0.5c21.8 ± 4.5b
Multiplied clumpspeat60 b133.9 ± 34.0b66.6 ± 14.0cd36.3 ± 19.6b2.0 ± 0.5bc22.0 ± 6.8b
peat + sand76 ab103.4 ± 18.0bc60.4 ± 11.0d20.0 ± 7.1c1.6 ± 0.7c10.8 ± 2.9c
peat + perlite88 a191.2 ± 43.0a73.8 ± 30.0bc71.8 ± 33.0a3.1 ± 1.0a28.4 ± 12.1a

Note: See Table 2

Genetic stability of in vitro propagated plants

The results showed that the ISSR primers generated a total of 40 and 36 amplification products ranging in size from 300 to 1400 bp for ‘Wojtek’ and ‘Zojka’ plants, respectively (Tab. 4). Among these bands, 0.0% and 2.77% were polymorphic for ‘Wojtek’ and ‘Zojka’ cultivars in relation to the mother plants. The AFLP primer pairs generated a total of 102 and 105 amplification products ranging in size from 50 to 900 bp for ‘Wojtek’ and ‘Zojka’ plants, respectively (Tab. 4). Among these bands, 0.98% and 1.90% were polymorphic for both ‘Wojtek’ and ‘Zojka’, compared to the mother plants.

The genetic evaluation of acclimatized plantlets of Lonicera caerulea ‘Wojtek’ and ‘Zojka’ compared to mother plants

No.PrimerTotal number of bandsNumber of polymorphic bandsRange of amplicon (pb)Total number of bandsNumber of polymorphic bandsRange of amplicon (pb)
‘Zojka’‘Wojtek’
1UBC 82591500–1000110400–1000
2UBC 81060600–130050500–1300
3UBC 827120300–800110300–750
4UBC 86590300–1400130300–1400
Total361400
Proportion of polymorphic bands (%)2,770,00
1Pst-CC/Mse-CC19180–30016150–300
2Pst-TT/Mse-CC351250–900300250–900
3Pst-GC/Mse-TA180300–850160400–850
4Pst-CG/Mse-AG420200–760400200–750
Total10521021
Proportion of polymorphic bands (%)1,900,98
DISCUSSION

Currently, in many commercial laboratories, microcuttings of several plant species are rooted directly, and root formation proceeds simultaneously with plantlet acclimatization. The costs of in vitro rooting, according to plant species, are calculated at 35–50% of the total micropropagation costs. Ex vitro rooting shortens the micropropagation time and reduces costs. So far, only the in vitro method has been successfully used to root blue honeysuckle shoots. During in vitro rooting, auxins were essential for achieving a high rooting percentage (Karhu 1997b; Sedlák & Paprštein 2007; Dziedzic 2008; Krupa-Małkiewicz et al. 2017). On the other hand, auxin presence in the medium stimulated unwanted callus formation at the base of the rooted shoots (Karhu 1997b; Wojtania et al. 2018). We are in agreement with Karhu (1997b), who observed that abundant callus blocked the formation of new roots and decreased the survival rate of blue honeysuckle transferred to ex vitro conditions. A high rooting percentage and a good ex vitro survival and root growth of L. caerulea f. edulis microplants were achieved by a 7-day pulse treatment with 0.8 mg·dm−3 IBA followed by rooting ex vitro (Karhu 1997b). Our study showed the possibility of successful ex vitro rooting of two L. caerulea var. kamtschatica cultivars ‘Wojtek’ and ‘Zojka’ without auxin treatments. It is worth noting that only 4% of ‘Wojtek’ and 40% of ‘Zojka’ microshoots were rooted in vitro if no auxin was supplied (Wojtania et al. 2018). Higher ex vitro rooting frequency in soil substrate without auxin treatment as compared to the agar medium might be due to a specific greenhouse environment. Similarly, as in our study, peat alone or a mixture of peat and perlite/vermiculite was proved to be a better substrate for rooting and ex vitro growth of blue honeysuckle than peat and sand (Karhu 1997b; Dziedzic 2008; Krupa-Małkiewicz et al. 2017).

The success of micropropagation is clearly dependent on maintaining the genetic stability of propagules. The risk of genetic instability may be minimalized through plant production by axillary branching. Blue honeysuckle easily produced in vitro primary and secondary branches in response to cytokinin treatment. However, increased cytokinin concentration enhanced the growth of callus at the base of the explants and the spontaneous formation of adventitious shoots (Karhu 1997a). We observed no morphological differences between micropropagated and mother plants of blue honeysuckle ‘Wojtek’ and ‘Zojka’. It is known that visible morphological variation occurs at a much lower frequency than at the DNA level (Evans & Bravo 1986; Krishna et al. 2016). So, it is important to ensure that the micropropagation protocol does not brings changes at the molecular level (Cloutier & Landry 1994; Krishna et al. 2016; Olhoft & Phillips 1999). In the literature, there is no information on genetic stability of blue honeysuckle micropropagated plants. Available reports focused on genetic variation between species and cultivars belonging to genus Lonicera (Lamoureux et al. 2011; Naugžemys et al. 2011; Gawroński et al. 2014; He et al. 2016; Holubec et al. 2018). To our knowledge, this is the first assessment of DNA sequence variation in Polish cultivars of L. caerulea var. kamtschatica. Two PCR-based techniques have been used to test clonal stability because of their simplicity, cost-effectiveness, being highly informative and reliable (Arnau et al. 2002). The use of the two different molecular markers, which amplify different regions of the genome, gives more chances for the identification of genetic variations in the micropropagated clones (Martins et al. 2005). The number of bands generated was greater in AFLP than ISSR analysis. After 2 years of in vitro propagation, no polymorphism was detected for plantlets of ‘Wojtek’, in contrast to AFLP markers (0.98% of polymorphic bands). For ‘Zojka’ plants, the degree of variation was on average 2.8% and was comparable for AFLP and ISSR markers. Differences in the results obtained with the ISSR and AFLP markers probably reflect the different genomic regions amplified by the two marker types. Similar results were obtained by some other authors (Martins et al. 2005; Lakshmanan et al. 2007; Kour et al. 2014) who used molecular markers to confirm the genetic stability of micropropagated plantlets. On the basis of our results, it is not possible to clearly indicate which type of molecular marker used in this study is better for assessing genetic stability in the studied cultivars. We suggest using the two different types of markers, which amplify different regions of the genome, to increase the probability of detecting genetic variations in the micro-propagated clones. In our research, combining the ISSR and AFLP data sets allowed a more comprehensive analysis of genetic stability of two Polish cultivars of blue honeysuckle and provided greater information about the genetic identity of micropropagated plants.

eISSN:
2300-5009
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
2 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Biotechnologie, Botanik, Ökologie, andere