Discovery of a new genus and species of Allocreadiidae (Trematoda) in Mexico:  n. gen. n. sp

B. Mendoza-Garfias; J. G. García-Teh; J. M. Caspeta-Mandujano; V. M. Vidal-Martínez; D. I. Hernández-Mena

Details zu Zeitschrift und Ausgabe

Helminthologia

Zeitschriftendaten

Format: Zeitschrift
eISSN: 1336-9083
Erstveröffentlichung: 22 Apr 2006
Erscheinungsweise: 4 Hefte pro Jahr
Sprachen: Englisch

Allocreadiidae is a family of trematodes with a cosmopolitan distribution, whose species in their adult stage parasitize mainly freshwater fish, although some parasitize marine fish and other vertebrates in freshwater habitats such as amphibians and snakes, and some species may also be progenetic in arthropods (Caira & Bogéa, 2005). Caira and Bogéa (2005) recognized 15 genera in the family and an additional 15 genera that were controversial. With new revisions on the morphology and the addition of genetic data for phylogenetic comparisons, several of the genera recognized by Caira and Bogéa (2005) have been synonymized or relocated to other families, and some new genera have been described; additionally, Megalogonia Surber, 1928 and Wallinia Pearse, 1920 were placed within the Allocreadiidae (Perez-Ponce de León et al., 2007). Therefore, 18 valid genera are currently recognized in Allocreadiidae (WoRMS 2022; Caira & Bogéa, 2005; Pérez-Ponce de León et al., 2013).

In the present century, four new genera have been described in the Americas: Auriculostoma Scholz, Aguirre-Macedo & Choudhury, 2004; Paracreptotrema Choudhury, Pérez Ponce de León, Brooks & Daverdin, 2006; Paracreptotrematoides Pérez Ponce de León, Pinacho-Pinacho, Mendoza-Garfias, Choudhury & García-Varela, 2016; and Pseudoparacreptotrema Pérez Ponce de León, Pinacho-Pinacho, Mendoza-Garfias, Choudhury & García-Varela, 2016. However, more recently it was found that Auriculostoma is a synonym of Creptotrema (Franceschini et al., 2021). The discovery in recent decades of new genera, their validity, and taxonomic changes, in principle, have been due to the boom in combining DNA sequence analysis with traditional morphological characters. Thanks to the use of molecular phylogenies, it was possible to determine that some morphological and host differences between the species provided strong evidence that they belonged to different genera (e.g. Pseudoparacreptotrema and Paracreptotrematoides from Paracreptotrema), but also made it possible to synonymize seemingly distinct genera (e.g. Auriculostoma with Creptotrema). In the case of this study, trematodes of Allocreadiidae were collected in the intestine of Atherinella alvarezi (Díaz-Pardo) (Atheriniformes), and we immediately noticed morphological differences that we had never observed before in allocreadiids. These differences were complemented with DNA sequences of the 28S and ITS from the ribosomal RNA region (rRNA)and the phylogenies obtained corroborated that the trematodes we found are a new genus and species. Therefore, the objective of this study is the description of this new taxon found in Mexico, to offer a hypothesis about its phylogenetic relationships, and to highlight the importance of integrative taxonomic studies in recognizing and understanding the diversity of trematodes.

Material and Methods

Sample collections

As a part of the study of helminth parasites of fishes in the Lacantún River from the Biosphere Reserve of Montes Azules, Chiapas, Mexico, 53 individuals of Atherinella alvarezi were caught using by electrofishing and cast nets in some tributaries and the main channel of the Lacantún River, next to the Chajul Station (16°06’38.4’’ N, 90°56’23.6’’ W) during January 2018. The fish were transported alive to a temporary field necropsy station, where they were necropsied for metazoan parasites by dissecting them and checking all the organs. Particularly, the gastrointestinal tract of each fish was placed in Petri dishes with some 6.5 % saline solution for examination under a stereomicroscope.

The trematodes of the same morphotype were separated into two groups: some were killed and fixed with 4 % hot (nearly boiling) formaldehyde and

stored in vials for morphological study; others were placed directly into vials with absolute ethanol while still alive for DNA extraction and molecular studies.

Morphological study

Of the specimens fixed in 4 % formaldehyde for morphology, 28 were stained with Gomori´s trichrome and Mayer’s paracarmine, cleared in methyl salicylate, and mounted in Canada balsam. These specimens were observed, measured, and drawn using an Olympus DIC Nomarski-BX50 microscope (Olympus Corporation, Tokyo, Japan) equipped with a drawing tube; measurements are presented in micrometers (μm) with the range followed by the mean in parentheses. Two other specimens were processed for scanning electron microscopy (SEM) as follows: specimens were dehydrated in a graded ethanol series (30 %, 50 %, 70 %, 96 % and 100 %), dried at the critical point with carbon dioxide; these specimens were mounted on a metal stub with carbon adhesive tabs, then gold coated, and examined at 10 kV with a Hitachi Stereoscan SU1510 SEM (Hitachi Ltd., Chiyoda, Tokyo, Japan). Specimens were deposited in the Colección Nacional de Helmintos UNAM (CNHE), in the Colección Helmintológica from CINVESTAV Mérida (CHCM), in Natural History Museum of Geneva (MHNG).

Molecular study

To extract genomic DNA, five specimens were digested separately, using the REDExtract-N-Amp Tissue PCR kit (Sigma, St. Louis, Missouri, USA) following the manufacturer’s instructions. Proteinase was denatured at 95º C for 3 min. The ITS (ITS1+5.8S+ITS2) region and 28S rRNA gene (Domains D1+D2+D3) were amplified using polymerase chain reaction (PCR). For ITS, the primers BD1 5′–GTCGTAACAAGGTTTCCGTA–3′, and BD2 5′–TATGCTTAAATTCAGCGGGT–3′ (Luton et al., 1992) were used; for the 28S, the primers 391 5′-AGCGGAGGAAAAGAAACTAA-3′ (Nadler & Hudspeth, 1998) and 536 5’-CAGCTATCCTGAGGGAAAC-3’ (Stock et al., 2001) were used. The PCR was performed in a final volume of 25μl containing 2 μl of genomic DNA, 14.25 μl of ultrapure water, 1 μl of each primer, 2.5 μl of 10x buffer A, 1.5 μl of MgCl₂ at 25 mM, 2.5 μl of dNTPs at 2 mM, and 0.25 μl (1 U) of Taq DNA polymerase (Vivantis, Shah Alam, Selangor Darul Ehsan, Malaysia). All PCR reactions were run in an Axygen® MaxyGene™ II thermocycler. Thermal cycling conditions for both ITS and 28S consisted of 95°C for 5 min followed by 35 cycles of 94°C for 1 min, 50 °C for 1 min and 72°C for 1 min, with a final extension at 72 °C for 10 min. Sequencing was performed using the amplification primers plus the internal primers: 503 5’-CCTTGGTCCGTGTTTCAAGACG-3’ (Stock et al., 2001) and 504 5’-CGTCTTGAAACACGGACTAAGG-3’ (García-Varela & Nadler, 2005) for 28S; BD3 5′-GAACATCGACATCTTGAACG-3′ and BD4 5′-ATAAGCCGACCCTCGGC-3′ (Hernández-Mena et al., 2014) for ITS. PCR products were sequenced using an ABI 3500xL Genetic Analyser (Applied Biosystems, Waltham, Massachusetts, USA) in the Laboratorio de Secuenciación Genómica de la Biodiversidad y de la Salud, Instituto de Biología, Universidad Nacional Autónoma de México. Finally, from the resulting sequences, a consensus sequence was obtained for each gene of each extracted specimen using the Geneious Pro 4.8.4 software (Biomatters Ltd., Auckland, New Zealand). Sequences were submitted to GenBank.

Phylogenetic analyses

Phylogenetic analyzes were performed for the 28S gene, because it is the gene with most sequences for species of Allocreadidae. To build this dataset, most of the sequenced species available in Genbank were added (see Table 1) using the Mesquite 3.62 software (https://www.mesquiteproject.org/). Callodistomidae species were used as outgroup for rooting the trees. The alignment of the sequences was performed with the SATé software, using the following configuration: Aligner = MAFT, Merger = MUSCLE, Tree Estimator = RAXML, Model = GTRCAT, Iteration limit= 200, Tree Return= Best (Liu et al., 2009, 2012). The best alignment was selected for phylogenetic analyses. Nucleotide substitution was estimated with jModelTest v2 (Darriba et al., 2012). Phylogenetic trees were generated with maximum likelihood (ML) and Bayesian inference (BI). For ML analysis, RaxmlGUI v. 1.3 software (Silvestro & Michalak, 2012) was employed to estimate the best tree under the GTR+I+G model and where 1,000 bootstrap repetitions (Bt) were run to estimate the support of the nodes. For the BI analysis we used MrBayes v. 3.2.1 (Ronquist et al., 2012), in which four independent MCMC runs of 20 million generations each were performed. For each run, four chains with a heating parameter value of 0.9 were employed, and the tree topologies were sampled every 1000 generations (printfreq = 1000 sample-freq = 1000 diagnfreq=10,000). Burn-in periods were set to the first 1500 generations. Nodal support was estimated as posterior probability values (PP) and a 50 % majority-rule consensus tree was obtained. The phylogenetic trees obtained were visualized in FigTree v. 1.4.2. Finally, genetic distances were calculated as uncorrected p-distance in MEGA v6 Software (Tamura et al., 2013).

Ethical Approval and/or Informed Consent

The research followed approval from the Ethics Committee of the Autonomous University of Nuevo Leon (UANL), and after obtaining a permit from the Secretaría del Medio Ambiente y Recursos Naturales (SEMARNAT), Mexico (permit numbers: FAUT-017 and SGPA/DGVS/03492).

Results

Morphological descriptions

Family: Allocreadiidae Looss, 1902

Genus: Mesoamericatrema Hernández-Mena, Mendoza-Garfias and Vidal-Martínez

Diagnosis. Body oval, widest at the level of ventral sucker. Tegument smooth, aspinose. Eyespot pigment present and scattered in forebody. Forebody with tegumental papillae on lateral sides.

Table 1

Trematode species included in phylogenetic analyses with the 28S rRNA gene. The accession number of the Genbank sequences, the host and the locality where the sequenced specimens were collected are shown.

Species	Author	GenBank	Host	Locality	Sequence Reference
ALLOCREADIIDAE	Looss, 1902
Acrolichanus auriculatum	(Wedl, 1858) Skvortsov, 1927	MN524579	Acipenser schrenckii	Russia	Atopkin et al., 2020
Allocreadium gotoi	(Hasegawa & Ozaki, 1926) Shimazu, 1988	LC215274	Misgurnus anguillicaudatus	Japan: Nagano, liyama, Midori	Shimazu, 2017
Allocreadium isoporum	(Looss, 1894) Looss, 1902	GU462125	Alburnus alburnus	Russia: Lake Oster, Karelia	Petkeviciüte et al., 2010
Allocreadium lobatum	Wallin, 1909	EF032693	Semotilus corporalis	USA	Curran et al., 2006
Allocreadium neotenicum	Peters, 1957	JX977132	Hydroporus rufifrons	United Kingdom: Lake District, Cumbria	Bray et al., 2012
Bunodera acerinae	Roitman & Sokolov, 1999	GU462122	Gymnocephalus cernua	Russia: River Tvertsa, upper Volga River basin	Petkeviciüte et al., 2010
Bunodera eucaliae	(Miller, 1936) Miller, 1940	DQ029329	Culaea inconstans	Canada: Brokenhead River, Manitoba	Choudhury and Leon-Regagnon, 2005
Bunodera inconstans	(Lasee, Font & Sutherland, 1988) Brooks, 1992	DQ029330	Culaea inconstans	Canada: Brokenhead River, Manitoba	Choudhury and Leon-Regagnon, 2005
Bunodera luciopercae	(Müller, 1776) Lühe, 1909	GU462113	Sphaerium rivicola	Russia: River Tvertsa, upper Volga River basin	Petkeviciüte et al., 2010
Bunodera mediovitellata	Tsimbalyuk & Roitman, 1966	DQ029332	Gasterosteus aculeatus	Canada: Little Campbell River, B. C.	Choudhury and Leon-Regagnon, 2005
Bunodera sacculata	Van Cleave & Mueller, 1932	DQ029333	Perea fluviatilis	Canada: Lake Sasajewun, Algonquin Park, Ontario	Choudhury and Leon-Regagnon, 2005
Bunodera vytautasi	Atopkin, Sokolov, Shedko, Vainutis & Orlovskaya, 2018	MG262545	Pungitius pungitius	Canada: Magadan region, Chernoe Lake	Atopkin et al., 2018
Crepidostomum affine	Tkach, Curran, Bell & Overstreet, 2013	KF250358	Hiodon tergisus	USA: Pearl River,Mississippi	Tkach, et a/., 2013
Crepidostomum auritum	(MacCallum, 1919)	KF250357	Aplodinotus grunniens	USA: Pearl River,Mississippi	Tkach, et a/., 2013
Crepidostomum cooperi	Hopkins, 1932	DQ029328	Percopsis omiscomaycus	Canada: Lake Winnipeg, Manitoba	Choudhury and Leon-Regagnon, 2005
Crepidostomum cornutum	(Osborn, 1903) Stafford, 1904	EF032695	Lepomis gulosus	USA	Curran et al., 2006
Crepidostomum farionis	(Müller, 1780) Lühe, 1909	FR821399	Oncorhynchus masou	Russia	Atopkin and Shedko, 2014
Crepidostomum illinoiense	Faust, 1918	KF356372	Hiodon alosoides	USA: Red Lake River,Minnesota	Tkach, et a/., 2013
Crepidostomum metoecus	(Braun, 1900) Braun, 1900	FR82140	Salvelinus leucomaensis	Russia	Atopkin and Shedko, 2014
Crepidostomum nemachilus	Krotov, 1959	FR821408	Salvelinus leucomaensis	Russia	Atopkin and Shedko, 2014
Crepidostomum oschmarini	Zhokhov & Pugacheva, 1998	MH159994	Pisidium casertanum	Lithuania: River Nedzinge	Petkeviciüte et al., 2018
Creptotrema astyanace	(Scholz, Aguirre-Macedo & Choudhury, 2004) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	HQ833707	Astyanax aeneus	Costa Rica: Guanacaste	Curran etal., 2011
Creptotrema stenopteri	(Mane-Garzon & Gascon, 1973) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	MN822005	Charax stenopteri	Argentina: Buenos Aires, Punta Lara	Montes et al., 2021
Creptotrema conconae	Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	OK044374	Imparfinis mirini	Brazil: Upper Parana River basin	Franceschini et al., 2021
Creptotrema creptotrema	Travassos, Artigas & Pereira, 1928	OK044371	Megaleporinus elongatus	Brazil: Mogi-Guacu River, Upper Parana River basin	Franceschini et al., 2021
Creptotrema funduli	Mueller, 1934	JQ425256	Fundulus notatus	USA: Mississippi, Biloxi River, Harrison County	Curran et al., 2012
Creptotrema guacurarii	(Montes, Barneche, Croci, Balcazar, Almiron, Martorelli & Perez-Ponce de Leon, 2021) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	MN822004	Characidium heirmostigmata	Argentina: Misiones, Parque Nacional Iguazu	Montes et al., 2021
Creptotrema lobata	(Hernändez-Mena, Lynggaard, Mendoza-Garfias & Perez- Ponce de Leon, 2016) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	KX954170	Brycon guatemalensis	Mexico: Tenosique, Chiapas	Hernändez-Mena etal., 2016
Creptotrema megacetabularis	Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	OK044375	Auchenipterus osteomystax	Brazil: Upper Parana River basin	Franceschini et al., 2021
Creptotrema schubarti	Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	OK044373	Characidium schubarti	Brazil: Upper Parana River basin	Franceschini et al., 2021
Creptotrema tica	(Hernandez Mena, Pinacho-Pinacho, Garcia-Varela, Mendoza- Garfias & Perez-Ponce de Leon, 2018) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	MH997001	Gymnotus maculosus	Costa Rica: Creek at Pitaya, Guanacaste	Hernändez-Mena etal., 2019
Creptotrema totonacapanensis	(Razo-Mendivil, Mendoza-Garfias, Perez- Ponce de Leon & Rubio-Godoy, 2014) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	KF631417	Astyanax mexicanus	Mexico: Filipinas, Veracruz	Razo-Mendivil et al., 2014b
Creptotrematina aguirrepequenoi	Jimenez-Guzman, 1973	HQ833708	Astyanax aeneus	Costa Rica: Guanacaste	Curran etal., 2011
Creptotrematina batalhensis	Dias & Abdallah in Alves Dias, Perez-Ponce de Leon, Almeida Camargo, Müller, Silva, Kozlowiski de Azevedo & Abdallah, 2020	MT512642	Astyanax lacustris	Brazil: Batalha River	Dias et al., 2020
Margotrema bravoae	Lamothe-Argumedo, 1970	KT833278	Allotoca dugesii	Mexico (Central region)	Perez-Ponce de Leon et al., 2016
Margotrema resolanae	Perez-Ponce de Leon, Martinez-Aquino & Mendoza-Garfias, 2013	KT833271	Xenotaenia resolanae	Mexico (Central region)	Perez-Ponce de Leon et al., 2016
Megalogonia ictaluri	Surber, 1928	EF032694	Ictalurus punctatus	USA: Pearl River, Mississippi	Curran et al., 2006
Mesoamericatrema magnisacculus	This study	OP279638- OP279642	Atherinella alvarezi	Mexico: Arroyo San Jose, Chiapas	This study
Paracreptotrema blancoi	Choudhury, Perez Ponce de Leon, Brooks & Daverdin, 2006	KT833285	Priapichthys annectens	Costa Rica: Orosi River	Perez-Ponce de Leon et al., 2016
Paracreptotrema rosenthali	Bautista-Hernandez, Monks, Pulido-Flores & Miranda, 2015	KT833287	Xiphophorus malinche	Mexico: Malila River, Hidalgo	Perez-Ponce de Leon et al., 2016
Paracreptotrematoides heterandriae	(Salgado-Maldonado, Caspeta-Mandujano & Vazquez, 2012) Perez Ponce de Leon, Pinacho-Pinacho, Mendoza-Garfias, Choudhury & Garcia-Varela, 2016	KF697693	Heterandria bimaculata	Mexico: Agua Bendita, Xico, Veracruz	Razo-Mendivil et al., 2014a
Pseudoparacreptotrema axtlaensis	Mendoza-Garfias & Choudhury, 2020	MT180832	Agonostomus monticola	Mexico: Axtla de Terrazas, San Luis Potosi	Perez-Ponce de Leon et al., 2020
Pseudoparacreptotrema falciformis	Hernändez-Mena & Pinacho-Pinacho, 2020	MT180829	Agonostomus monticola	Mexico: Matias Romero, Oaxaca	Perez-Ponce de Leon et al., 2020
Pseudoparacreptotrema macroacetabulata	Perez Ponce de Leon, Pinacho-Pinacho, Mendoza-Garfias, Choudhury & Garcia-Varela, 2016	KT833322	Profundulus kreiseri	Guatemala: Puente Sansare	Perez-Ponce de Leon et al., 2016
Pseudoparacreptotrema pacificum	Sereno-Uribe & Garcia-Varela, 2020	MT180810	Agonostomus monticola	Costa Rica: Rio Lajas	Perez-Ponce de Leon et al., 2020
Pseudoparacreptotrema profundulusi	(Salgado-Maldonado, Caspeta-Mandujano & Martinez- Ramirez, 2011) Perez Ponce de Leon, Pinacho-Pinacho, Mendoza-Garfias, Choudhury & Garcia-Varela, 2016	KT833290	Profundulus sp.	Mexico: Templo River, San Juan del Rio, Oaxaca	Perez-Ponce de Leon et al., 2016
Wallinia anindoi	Hernändez Mena, Pinacho-Pinacho, Garcia-Varela, Mendoza- Garfias & Perez-Ponce de Leon, 2018	MH997003	Astyanax aeneus	Mexico: San Juan del Rio, Oaxaca	Hernändez Mena et al., 2018
Wallinia brasiliensis	Dias, Müller, Almeida, Silva, Azevedo, Perez-Ponce de Leon & Abdallah, 2018	MH520995	Astyanax fasciatus	Brazil: Upper Paranä River Basin	Dias et al., 2018
Wallinia caririensis	Silva, Dias, Silva & Yamada, 2020	MW024866	Astyanax bimaculatus	Brazil: Batateiras River	da Silva et al., 2021
Wallinia chavarriae	Choudhury, Daverdin & Brooks, 2002	HC833703	Astyanax aeneus	Costa Rica: Animas River, Guanacaste	Curran et al., 2011
Wallinia mexicana	Perez-Ponce de Leon, Razo-Mendivil, Mendoza-Garfia, Rubio-Godoy & Choudhury, 2015	KJ535504	Astyanax mexicanus	Mexico: Covadonga River, Durango	Perez-Ponce de Leon et al., 2016
CALLODISTOMIDAE	Odhner, 1910
Prosthenhystera caballeroi	Jimenez-Guzmän, 1973	KM871185	Astyanax aeneus	Costa Rica: Tampisquto River, Guanacaste	Tkach and Curran, 2015
Prosthenhystera obesa	(Diesing, 1850) Travassos, 1922	AY222206	Hoplias sp.	Peru: Itaya River, Iquitos	Olson et al., 2003
Prosthenhystera oonastica	Tkach & Curran, 2015	KM871181	Pylodictis olivaris	USA: Pearl River, Mississippi	Tkach and Curran, 2015

Oral sucker spherical, subterminal, with oral papillae, 6 or more anterior external, 4 on inner surface (2 near mouth) and 5 posterior external. Oral lappets or lobes lacking. Ventral sucker spherical, muscular, slightly larger than oral sucker. Mouth subterminal. Prepharynx absent. Pharynx rounded, muscular. Esophagus short. Intestinal bifurcation in mid-forebody; caeca terminating at level of posterior testis. Testes two, rounded, entire, tandem, overlapping or slightly separate, in posterior half of hindbody. Cirrus sac very large in proportion to body length, elongate, median, claviform, extending to ovary. Seminal vesicle unipartite, continuous. Pars prostatica ovoid. Ejaculatory duct longer than pars prostatica. Cirrus not observed. Genital atrium indistinct. Genital pore median, between intestinal bifurcation and ventral sucker. Ovary globular, smooth, sinistral, post-equatorial, pre-testicular, posterior to ventral sucker. Seminal receptacle flask-shaped. Mehlis’ gland between ovary and anterior testis. Laurer’s canal opening on dorsal surface of body. Vitelline follicles large, in two ventro-lateral fields not confluent, from intestinal bifurcation to posterior end of body. Uterus not extending posteriorly beyond anterior margin of anterior testis, with few eggs (from 2 to 5). Metraterm similar in length to cirrus sac. Eggs oval and operculate. Excretory vesicle I-shaped, extending to anterior testis. Excretory pore terminal. Parasites in the intestine of atherinopsids (Atheriniformes: Atherinopsidae), in Middle America.

Taxonomic summary

Type species: Mesoamericatrema magnisacculus Hernández-Mena, García-Teh and Caspeta-Mandujano n. sp.

Type host: Atherinella alvarezi (Díaz-Pardo, 1972), Gulf silverside (= Plateadito de Tacotalpa in spanish) (Atheriniformes: Atherinopsidae).

Infection site: Intestine.

Type locality: Arroyo San José, Chiapas, Mexico (16°06’50.0” N, 90°56’03.3” W).

Other localities: Arroyo San Pablo, Chiapas, Mexico (16°06’10.0” N, 91°00’52.2” W).

Etymology: The name of the genus reflects the fact that the type species is distributed in Mexico, in a portion of the cultural region known as “Mesoamerica” that includes from the southern half of Mexico to Nicaragua.

Zoobank Life Science Identifier: urn:lsid:zoobank. org:act:733A83FD-3C04-4304-A1D4-507F2CD12090

Remarks

Mesoamericatrema n. gen. possesses all the adult characteristics of the family Allocreadiidae as stated by Caira and Bogéa (2005), such as an aspinose tegument, unarmed cirrus (when observable), well developed cirrus sac, lack of an external seminal vesicle, and the general disposition of the vitelline follicles and gonads. The new genus can be easily distinguished from Acrolichanus Ward, 1917, Bunodera Railliet, 1896, Bunoderella Schell, 1964, Crepidostomum Braun, 1900, Creptotrema Travassos, Artigas & Pereira, 1928, Creptotrematina Yamaguti, 1954, Megalogonia Surber, 1928, Paracrepidostomum Lü & Wu, 1996, Rastridostomum Bilqees, Khatoon, Bibi & Mutiur-Rehman, 2007, Trematichtys Vaz, 1932, because Mesoamericatrema n. gen. does not have oral lappets or oral lobes on the oral sucker (Caira & Bogéa, 2005; Franceschini et al., 2021), while the other genera have lobes or lappets protruding from the oral sucker.

On the other hand, Mesoamericatrema n. gen. is easily differentiated from Allocreadium Looss, 1900, Caudouterina Martin, 1966, Margotrema Lamothe-Argumedo, 1970, Paracreptotrema, Paracreptotrematoides, Pseudallocreadium Yamaguti, 1971, Pseudoparacreptotrema, and Wallinia because the new genus has a very elongated cirrus sac that is large in proportion to body size (1: 2.1–2.9) and extends posteriorly beyond the ventral sucker to the ovary, while in the other genera the cirrus sac is small or slightly elongated and does not extend posteriorly beyond the ventral sucker (with the exception of Wallinia, where the sac extends only slightly beyond the ventral sucker). Additionally, the new genus can be distinguished from the others by the combination of some morphological characters, such as the distribution of testes, vitelline follicles, the uterus and the number of eggs: Mesoamericatrema n. gen. presents testes in tandem, non-confluent vitelline follicles extending posteriorly to the posterior end of the body, a pre-testicular uterus, with very few eggs; Margotrema has oblique testes, and non-confluent vitelline follicles that do not reach the testes, post-testicular uterus, with numerous eggs; Caudouterina has oblique testes, vitelline follicles confluent in the anterior region of the ventral sucker and extending posteriorly near the posterior end of body, and a post-testicular uterus with numerous eggs; Wallinia has oblique testes, non-confluent vitelline follicles extending posteriorly between the posterior testis and the end of caeca, and a post-testicular uterus with numerous eggs; Pseudallocreadium and Allocreadium have testes that are oblique or in tandem respectively, vitelline follicles that are confluent in the post-testicular region and extend posteriorly to the posterior end of the body, and a pre-testicular uterus with numerous eggs; Paracreptotrema and Paracreptotrematoides have symmetrical testes, non-confluent vitelline follicles extending posteriorly only to the testes, uterus extending into testicular space, with relative few eggs; finally, Pseudoparacreptotrema has symmetrical or oblique testes, vitelline follicles that are confluent in post-testicular region and testicular region extending posteriorly to the posterior end of the body, uterus extending into the testicular space, and relatively few eggs.

Mesoamericatrema magnisacculus Hernández-Mena, García-Teh and Caspeta-Mandujano n. sp

Description (Based on 19 adult specimens from Arroyo San José, and 9 adult specimens from Arroyo San Pablo, Chiapas, Mexico; Figs 1, 2 and 3). Body aspinose, oval, small, 465–710 (574) long, maximum width 155–230 (201) at posterior region of ventral sucker; anterior end rounded. Tegument smooth. Eyespot pigment scattered in forebody at level of pharynx. Forebody, 140–200 (162) long; forebody length to total body length ratio 1: 3.3–3.6 (3.5). Hindbody with ventro-lateral tegumental papillae in the first half of the segment, 232–400 (314) long; forebody length to hindbody length ratio 1:1.6–2.3 (1.9), first half of hindbody with ventro-lateral tegumental papillae. Oral sucker spherical, subterminal, 62–85 (69) long, 67–75 (70) wide, with oral papillae: 6 or more anterior external, 4 on inner surface (2 near mouth) and 5 posterior external (Fig. 2). Oral lappets or lobes lacking (Fig. 2). Mouth subterminal. Ventral sucker spherical with circular opening, larger than oral sucker, muscular, 88–110 (97) long by 85–102 (96) wide. Oral sucker length to ventral sucker length ratio 1: 1.3–1.6 (1.4); Oral sucker width to ventral sucker width radio 1:1.3–1.5 (1.4Prepharynx absent. Pharynx rounded, muscular 30–45 (36) long by 33–40 (36) wide. Esophagus very short, almost imperceptible and narrow. Intestinal bifurcation in mid-forebody, 95–120 (103) from anterior end of body; caeca long, narrow, terminating at level of the posterior testis, 332–462 (380) long, 15–25 (19) wide. Testes two, symmetrical, rounded, smooth, entire, medial, tandem, overlapping or slightly separate, located in posterior half of hindbody. Anterior testis 50–55 (52) long by 45–57 (52) wide. Posterior testis 49–62 (54) long by 49–60 (54) wide, to 65–125 (84) from posterior end of body. Cirrus sac elongate, median, dorsal, claviform, narrower anteriorly and much broader posteriorly, extending from genital pore to anterior half of ovary, 176–332 (224) long, 83–112 (100) wide; cirrus sac length to body length ratio 1: 2.1–2.9 (2.6). Seminal vesicle unipartite, folded, continuous, in posterior part of cirrus-sac, 50–100 (62) long, 50–80 (61) wide. Pars prostatica ovoid 45–62 (52) long by 12–30 (24) wide, surrounded by prostatic cells. Ejaculatory duct longer than pars prostatica, 67–117 (91) long by 10–20 (13) wide. Cirrus not observed. Genital atrium indistinct. Genital pore slit-like, median, between the intestinal bifurcation and the ventral sucker. Ovary globular, unlobed, margin smooth, 52–75 (64) long, 50–75 (61) wide, sinistral, post-equatorial, pre-testicular, between ventral sucker and anterior testis, at 37–78 (56) from posterior margin of ventral sucker. Seminal receptacle flask-shaped, 35–46 (39) long, 55–75 (62) wide, between ovary and anterior testis. Mehlis’ gland composed of scattered gland cells, between ovary and anterior testis. Laurer’s canal indistinct in most specimens, in one specimen opening on dorsal surface of body lateral to the outer border of caecum, at level of ovary. Ootype not observed. Vitellarium formed by large follicles, distributed in two ventro-lateral fields not confluent, extending from intestinal bifurcation level to near posterior extremity of body; follicles overlapping caeca ventrally; vitelline ducts uniting near seminal receptacle to form vitelline reservoir. Uterus intercaecal, forming loops between anterior testis and cirrus sac. Metraterm thick-walled, similar in length to cirrus sac. Eggs oval, operculate, few (2–5), 37–52 (47) long, 32–42 wide (38). Excretory vesicle I-shaped, 140–238 (177) long, 10–18 (14) wide, extending anteriorly to middle of anterior testis. Excretory pore terminal.

Mesoamericatrema magnisacculus n. sp.: a) Dorso-ventral view of the holotype (scale bar= 200 μm); a) Lateral view of a paratype (scale bar= 200 μm); c) and d) Ventral view of two different male genitalia, showing the cirrus sac containing the seminal vesicle, the pars prostatica, and the ejaculatory duct (scale bar= 100 μm). The seminal vesicle is embedded in a very thick sac.

Scanning electron micrographs of Mesoamericatrema magnisacculus n. sp.: A) ventral view of the entire body (scale bar= 100 μm); B) and C) ventral view of two different oral suckers showing the oral papillae (6 external anterior in blue arrows, 4 internal in green arrows and 5 external posterior in red arrows; scale bar= 25 μm); d) ventral view of the ventral sucker (scale bar= 25 μm); e) ventral view of terminal excretory pore at posterior end of hindbody (scale bar= 25 μm); f) close-up of an external oral papilla (scale bar= 5 μm); g) sperm leaving the genital pore (scale bar= 5 μm); h) egg released through the genital pore (scale bar= 25 μm).

Photographs where the size of the cirrus bag is observed with respect to the size of the body. The length of the ejaculatory duct, the pars prostatica and the seminal vesicle, which is surrounded by a thick wall of the sac, are also observed; a), b) and c) paratypes stained with Mayer’s paracarmine; d) paratype stained with Gomori’s trichrome. Scale bar= 50 μm.

Maximum Likelihood phylogenetic tree of the 28S gene for Allocreadiidae species, showing the position of the new genus that is highlighted in bold red font (–ln= 9888.861897). Numbers near internal nodes indicate bootstrap support and posterior probabilities values.

Taxonomic summary

Type host: Atherinella alvarezi (Díaz-Pardo, 1972), Gulf silverside (= Plateadito de Tacotalpa in spanish) (Atheriniformes: Atherinopsidae).

Infection site: Intestine

Type locality: Arroyo San José, Chiapas, México (16°06’50.0” N, 90°56’03.3” W).

Other localities: Arroyo San Pablo, Chiapas, Mexico (16°06’10.0” N, 91°00’52.2” W).

Type material: Holotype CNHE 11671; Paratypes CNHE 11672 (n=5) and CNHE 11663 (n=5); Paratypes CHCM 670 (n=4) and CHCM 671 (n=3); Paratypes MHNG PLAT-0144002 (n=4).

Representative DNA sequences: 28S rRNA (OP279638 – OP279642); ITS rRNA (OP279696 – OP279697).

Etymology: The specific name reflects the fact that this species has a cirrus sac that is huge in proportion to its body length.

Zoobank Life Science Identifier: urn:lsid:zoobank.org:act:0520E4B6-B22F-433E-AF28-C6E32A4D84A9

Remarks

Phylogenetically, the new species is related to species of genera that are distributed in the Neotropical region: Creptotrema, Creptotrematina, Paracreptotrema, Paracreptotrematoides, Pseudoparacreptotrema, and Wallinia (see below for results of the phylogenetic analyses). Mesoamericatrema magnisacculus n. sp. is easily distinguishable from all species of Creptotrema and Creptotrematina, and from some species of Pseudoparacreptotrema (i. e. P. falciformis Hernández-Mena & Pinacho-Pinacho, 2020 and P. axtlaensis Mendoza-Garfias & Choudhury, 2020) because the new species lacks lappets or lobes protruding from the oral sucker.

The new species is distinguished from all species of Wallinia, Paracreptotrema, Paracreptotrematoides, and from the remaining species of Pseudoparacreptotrema, because M. magnisacculus n. sp. has a very large cirrus sac (1: 2.1–2.9) that posteriorly surpasses the ventral sucker and extends to the ovary, whereas in Wallinia species it is

is moderately elongated and only slightly extends past the ventral sucker, and in the species of Paracreptotrema, Paracreptotrematoides and Pseudoparacreptotrema is short and never extends beyond the posterior level of the ventral sucker. Additionally, the new species has testes in tandem and a pre-testicular uterus with very few eggs; Wallinia species have oblique testes and a post-testicular uterus with numerous eggs; Paracreptotrema and Paracreptotrematoides species have symmetrical testes and a uterus that contains relatively few eggs and extends into the testicular space; and Pseudoparacreptotrema species have symmetrical or oblique testes and uterus that also contains relatively few eggs and extends into the testicular space. Furthermore, M. magnisacculus n. sp. possesses non-confluent vitelline follicles while Pseudoparacreptotrema species possess confluent vitelline follicles in the post- testicular and testicular regions.

Phylogenetic analysis

The 28S data set was formed of a matrix of 51 species in 13 genera of Allocreadiidae (see Table 1). The length of the sequences in the aligned matrix was 1500 bp. The substitution model was GTR+G+I and the nucleotide frequencies were: A= 0.212, C= 0.214, G=0.318, T=0.256. The ML tree value was –ln= 9888.861897. Both the ML tree and the BI consensus tree presented practically the same topology. Regarding the phylogenetic relationships, all genera, except for Crepidostomum and Creptotrema, were monophyletic. In the case of Creptotrema, previous studies have already suggested that C. funduli, due to its phylogenetic position and geographical distribution, is a different genus and that this species needs a new morphological and taxonomic review (Pérez-Ponce de Léon et al. 2020); therefore, Creptotema sensu stricto included the rest of the species that formed a monophyletic group. In the tree, it was observed that the phylogenetic relationships of the species were consistent with the regions where they are distributed, i.e. the Holarctic and Neotropical regions. The species of the Neotropical region formed a monophyletic clade that was made up of seven genera with high support values (Bt=88; PP=0.99), where the new genus also nested: Creptotrema, Creptotrematina, Mesoamericatrema n. gen., Paracreptotrema, Paracreptotrematoides, Pseudoparacreptotrema and Wallinia. Mesoamericatrema, was placed as the sister group of the subclade (Creptotrematina + (Wallinia + Creptotrema)) (Bt=53; PP=0.98). The genetic distances in the 28S rDNA between Mesoamericatrema magnisacculus n. sp. and the species of the genera of the sister subclade were variable: from 4.59 to 5.46 % with Creptotrematina species, from 3.94 to 6.24 % with Wallinia species and from 3.75 to 6.42 % with Creptotrema species (Table 2). On the other hand, the genetic distances in the ITS gene between Mesoamericatrema magnisacculus n. sp. and species of the genera of the sister subclade were also variable, varying from 4.81 to 5.65 % with Creptotrematina species, 5.12 % with Wallinia chavarriae and from 4.40 to 4.94 % with Creptotrema species (Table 2).

Table 2

Genetic distances between Mesoamericatrema magnisacculus n. gen. n. sp. and the Allocreadiidae species of the Neotropical clade in the 28S and ITS ribosomal genes (na= sequences not available in Genbank).

Species	Mesoamericatrema magnisacculus
Species	28S	ITS
Creptotrema schubarti	5.63	na
Creptotrema guacurarii	5.37	na
Creptotrema creptotrema	5.53	na
Creptotrema tica	3.75	na
Creptotrema cf. stenopteri	5.01	na
Creptotrema megacetabularis	4.71	na
Creptotrema totonacapanensis	3.83	4.94
Creptotrema conconae	6.42	na
Creptotrema lobata	3.75	4.63
Creptotrema astyanace	3.79	4.40
Wallinia brasiliensis	5.20	na
Wallinia anindoi	5.43	na
Wallinia caririensis	6.24	na
Wallinia mexicana	5.76	na
Wallinia chavarriae	3.94	5.12
Creptotrematina batalhensis	5.46	4.81
Creptotrematina aguirrepequenoi	4.59	5.65
Paracreptotrema blancoi	3.91	7.29
Paracreptotrema rosenthali	5.69	8.27
Paracreptotrematoides heterandriae	4.62	4.34
Pseudoparacreptotrema axtlaense	5.03	na
Pseudoparacreptotrema falciforme	4.86	na
Pseudoparacreptotrema macroacetabulatum	3.93	7.56
Pseudoparacreptotrema pacificum	5.61	na
Pseudoparacreptotrema profundulusi	5.29	7.56

Discussion

The results of our study revealed the existence of a new genus of Allocreadiidae that parasitizes the fish Atherinella alvarezi. The discovery of the new genus named Mesoamericatrema n. gen. was based on the comparative study of internal and external morphological characters (using SEM), on the host association, and on the phylogenetic analysis of the 28S region (domains D1, D2, and D3) of the ribosomal RNA unit. Morphologically, the new genus presents a very large cirrus sac in proportion to the length of its body (1: 2.1–2.9), a characteristic that easily differentiates it from the other genera of Allocreadiidae, since generally the species of the other genera have a cirrus sac that does not extend beyond the posterior margin of the ventral sucker, and when it does, the sac is not as large in proportion to the length of the body (Scholz et al. 2004; Caira & Bogéa, 2005; Choudhury et al., 2006; Pérez Ponce de León et al., 2016; Franceschini et al., 2021).

Scanning Electron Microscopy (SEM) images show that the external surface of the body of Mesoamericatrema n. gen. does not have spines, but it does have oral and ventro-lateral tegumental papillae, features it shares with other species of allocreadiids. In particular, the number of oral papillae can be variable, however, the papillae that are constant in number are the internal papillae close to the mouth (4) and the posterior external papillae (5). This peculiarity of the number of internal and posterior oral papillae had already been observed in other genera such as Creptotrema (Razo-Mendivil et al., 2014; Hernández-Mena et al., 2016; 2019; Montes et al., 2021), Paracreptotrema (Choudhury et al., 2006; Perez-Ponce de León et al., 2016), Paracreptotrematoides (Perez-Ponce de León et al., 2016), Pseudoparacreptotrema (Perez-Ponce de León et al., 2016; 2020) and Wallinia (Hernández-Mena et al., 2019), which usually also have 4 internal papillae and 5 external posterior papillae, which suggests that so this character may be associated with this group of allocreadiids and may even be a synapomorphy for this large Neotropical clade. As a result, we suggest that it be included in the general diagnosis of these aforementioned genera. Unfortunately, not all recent descriptions of new species have SEM images, which makes it difficult to know if the number of oral papillae is a constant character in all species, so we propose that future descriptions include SEM observations to document the distribution of tegumental papillae and other surface features of these trematodes.

Mesoamericatrema n. gen. was nested within a clade that contains species and genera that geographically have a Neotropical and Middle American distribution, which extends from Argentina and Brazil to Mexico, passing through Central America. These genera are Creptotrema, Creptotrematina, Paracreptotrema, Paracreptotrematoides, Pseudoparacreptotrema, and Wallinia. More specifically, the new genus was grouped as the sibling taxon of the clade formed by Creptotrema + Creptotrematina + Wallinia with low bootstrap values but high posterior probabilities in clade support. The composition of the genera that make up the clade of Neotropical allocreadiids had also been previously reported by other authors (Pérez-Ponce de León et al., 2020; Franceschini et al., 2021), who mentioned that the grouping of these trematodes is related to their hosts which are freshwater fishes of Neotropical origin.

Species of all Neotropical genera have been recorded in Mexico, but other genera of allocreadiids have also been previously recorded, such as Allocreadium Looss, 1900, Crepidostomum Braun, 1900, Megalogonia Surber, 1928 and Margotrema Lamothe-Argumedo, 1970 (Perez-Ponce de León et al., 2007; Galaviz-Silva et al., 2013), which have rather a Neartic affinity, so that Mexico is clearly a country where historical geological processes have favored the coexistence of parasites and hosts (and other animals) with different biogeographical affinities (Aguilar-Aguilar et al., 2003; Miller et al., 2005; Pérez-Ponce de León & Choudhury, 2005; Chakrabarty & Albert, 2011; Choudhury et al., 2017; Morrone, 2014; 2020). The hydrological region and the host where the new genus was found have a Neotropical biogeographical affinity, so we expected that Mesoamericatrema n. gen. would nest in the clade of Neotropical allocreadiids instead of grouping with Neartic allocreadiids, a hypothesis that has been supported by the result of phylogenetic analyses. Therefore, the phylogenetic position of Mesoamericatrema n. gen. does correspond to the host and regional affinities of the Neotropical allocreadiids and increases the diversity of genera that have this affinity.

Neotropical allocreadiids parasitize freshwater fish of Neotropical origin (Albert & Reis, 2011) of the following orders (fig. 5): Creptotrema is in Characiformes, Gymnotiformes and Siluriformes; Creptotrematina and Wallinia have only been recorded in Characiformes; Paracreptotrema and Paracreptotrematoides have been found in Cyprinodontiformes; and Pseudoparacreptotrema has been found in Cyprinodontiformes and Mugiliformes. In this study, we found Mesoamericatrema magnisacculus n. sp. as an adult parasite of Atherinella alvarezi, a species of Atheriniformes endemic to the region (Albert & Reis, 2011). Previously, Salgado-Maldonado et al. (2014) had already reported an allocreadiid in A. alvarezi, which they only identified as “Allocreadidae gen. sp. b”. A review of this material allowed us to conclude that it is the taxon that we describe in this study. Thus, this is the first genus and species of allocreadiid that has an affinity for this group of fish. The host affinity of the new genus is consistent with the other genera with which it is phylogenetically grouped, and while their respective hosts do not have a common phylogenetic origin, all of them have evolved in the same biogeographical region. The fact that all Neotropical allocreadiids do not necessarily share the same group of fish (genus, family, or order), may imply that host-switching events have occurred during the evolution of this group of parasites due to the possible sympatry of the different groups of fish that have inhabited the same biogeographical zones.

Phylogenetic tree of the species of Allocreadiidae with Neotropical distribution, indicating their definitive hosts and the families of fish to which they belong with Neotropical affinity.

The following parasites have previously been recorded in A. alvarezi: the trematodes “Allocreadidae gen. sp. b”, and metacercariae of Posthodiplostomum minimum MacCallum, 1921 and Centrocestus formosanus Nishigori, 1924; the acanthocephalan Octospiniferoides chandleri Bullock, 1957; and the nematodes Spinitectus osorioi Choudhury and Pérez-Ponce de León, 2001, Rhabdochona sp., Contracaecum sp. and Spiroxys sp. (Moravec et al., 2010; Salgado-Maldonado et al., 2011; 2014). M. magnisacculus n. sp. represents the first species of trematode recorded to date that completes its life cycle in the intestine of A. alvarezi.

Mesoamericatrema n. gen. is the fifth genus of Allocreadiidae to be described in the Americas since 2004 and the third that has been discovered in Mexico since 2016, so it is important to mention that the discovery of this new genus increases parasite diversity both locally and regionally, providing support to the hypothesis that Middle America is indeed a very important region where notable speciation events have taken place in freshwater fish parasites (Choudhury et al., 2016, 2017).

Zahlen und Tabellen

Trematode species included in phylogenetic analyses with the 28S rRNA gene. The accession number of the Genbank sequences, the host and the locality where the sequenced specimens were collected are shown.

Species	Author	GenBank	Host	Locality	Sequence Reference
ALLOCREADIIDAE	Looss, 1902
Acrolichanus auriculatum	(Wedl, 1858) Skvortsov, 1927	MN524579	Acipenser schrenckii	Russia	Atopkin et al., 2020
Allocreadium gotoi	(Hasegawa & Ozaki, 1926) Shimazu, 1988	LC215274	Misgurnus anguillicaudatus	Japan: Nagano, liyama, Midori	Shimazu, 2017
Allocreadium isoporum	(Looss, 1894) Looss, 1902	GU462125	Alburnus alburnus	Russia: Lake Oster, Karelia	Petkeviciüte et al., 2010
Allocreadium lobatum	Wallin, 1909	EF032693	Semotilus corporalis	USA	Curran et al., 2006
Allocreadium neotenicum	Peters, 1957	JX977132	Hydroporus rufifrons	United Kingdom: Lake District, Cumbria	Bray et al., 2012
Bunodera acerinae	Roitman & Sokolov, 1999	GU462122	Gymnocephalus cernua	Russia: River Tvertsa, upper Volga River basin	Petkeviciüte et al., 2010
Bunodera eucaliae	(Miller, 1936) Miller, 1940	DQ029329	Culaea inconstans	Canada: Brokenhead River, Manitoba	Choudhury and Leon-Regagnon, 2005
Bunodera inconstans	(Lasee, Font & Sutherland, 1988) Brooks, 1992	DQ029330	Culaea inconstans	Canada: Brokenhead River, Manitoba	Choudhury and Leon-Regagnon, 2005
Bunodera luciopercae	(Müller, 1776) Lühe, 1909	GU462113	Sphaerium rivicola	Russia: River Tvertsa, upper Volga River basin	Petkeviciüte et al., 2010
Bunodera mediovitellata	Tsimbalyuk & Roitman, 1966	DQ029332	Gasterosteus aculeatus	Canada: Little Campbell River, B. C.	Choudhury and Leon-Regagnon, 2005
Bunodera sacculata	Van Cleave & Mueller, 1932	DQ029333	Perea fluviatilis	Canada: Lake Sasajewun, Algonquin Park, Ontario	Choudhury and Leon-Regagnon, 2005
Bunodera vytautasi	Atopkin, Sokolov, Shedko, Vainutis & Orlovskaya, 2018	MG262545	Pungitius pungitius	Canada: Magadan region, Chernoe Lake	Atopkin et al., 2018
Crepidostomum affine	Tkach, Curran, Bell & Overstreet, 2013	KF250358	Hiodon tergisus	USA: Pearl River,Mississippi	Tkach, et a/., 2013
Crepidostomum auritum	(MacCallum, 1919)	KF250357	Aplodinotus grunniens	USA: Pearl River,Mississippi	Tkach, et a/., 2013
Crepidostomum cooperi	Hopkins, 1932	DQ029328	Percopsis omiscomaycus	Canada: Lake Winnipeg, Manitoba	Choudhury and Leon-Regagnon, 2005
Crepidostomum cornutum	(Osborn, 1903) Stafford, 1904	EF032695	Lepomis gulosus	USA	Curran et al., 2006
Crepidostomum farionis	(Müller, 1780) Lühe, 1909	FR821399	Oncorhynchus masou	Russia	Atopkin and Shedko, 2014
Crepidostomum illinoiense	Faust, 1918	KF356372	Hiodon alosoides	USA: Red Lake River,Minnesota	Tkach, et a/., 2013
Crepidostomum metoecus	(Braun, 1900) Braun, 1900	FR82140	Salvelinus leucomaensis	Russia	Atopkin and Shedko, 2014
Crepidostomum nemachilus	Krotov, 1959	FR821408	Salvelinus leucomaensis	Russia	Atopkin and Shedko, 2014
Crepidostomum oschmarini	Zhokhov & Pugacheva, 1998	MH159994	Pisidium casertanum	Lithuania: River Nedzinge	Petkeviciüte et al., 2018
Creptotrema astyanace	(Scholz, Aguirre-Macedo & Choudhury, 2004) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	HQ833707	Astyanax aeneus	Costa Rica: Guanacaste	Curran etal., 2011
Creptotrema stenopteri	(Mane-Garzon & Gascon, 1973) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	MN822005	Charax stenopteri	Argentina: Buenos Aires, Punta Lara	Montes et al., 2021
Creptotrema conconae	Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	OK044374	Imparfinis mirini	Brazil: Upper Parana River basin	Franceschini et al., 2021
Creptotrema creptotrema	Travassos, Artigas & Pereira, 1928	OK044371	Megaleporinus elongatus	Brazil: Mogi-Guacu River, Upper Parana River basin	Franceschini et al., 2021
Creptotrema funduli	Mueller, 1934	JQ425256	Fundulus notatus	USA: Mississippi, Biloxi River, Harrison County	Curran et al., 2012
Creptotrema guacurarii	(Montes, Barneche, Croci, Balcazar, Almiron, Martorelli & Perez-Ponce de Leon, 2021) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	MN822004	Characidium heirmostigmata	Argentina: Misiones, Parque Nacional Iguazu	Montes et al., 2021
Creptotrema lobata	(Hernändez-Mena, Lynggaard, Mendoza-Garfias & Perez- Ponce de Leon, 2016) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	KX954170	Brycon guatemalensis	Mexico: Tenosique, Chiapas	Hernändez-Mena etal., 2016
Creptotrema megacetabularis	Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	OK044375	Auchenipterus osteomystax	Brazil: Upper Parana River basin	Franceschini et al., 2021
Creptotrema schubarti	Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	OK044373	Characidium schubarti	Brazil: Upper Parana River basin	Franceschini et al., 2021
Creptotrema tica	(Hernandez Mena, Pinacho-Pinacho, Garcia-Varela, Mendoza- Garfias & Perez-Ponce de Leon, 2018) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	MH997001	Gymnotus maculosus	Costa Rica: Creek at Pitaya, Guanacaste	Hernändez-Mena etal., 2019
Creptotrema totonacapanensis	(Razo-Mendivil, Mendoza-Garfias, Perez- Ponce de Leon & Rubio-Godoy, 2014) Franceschini, Aguiar, Zago, de Oliveira Fadel Yamada, Bertholdi Ebert & da Silva, 2021	KF631417	Astyanax mexicanus	Mexico: Filipinas, Veracruz	Razo-Mendivil et al., 2014b
Creptotrematina aguirrepequenoi	Jimenez-Guzman, 1973	HQ833708	Astyanax aeneus	Costa Rica: Guanacaste	Curran etal., 2011
Creptotrematina batalhensis	Dias & Abdallah in Alves Dias, Perez-Ponce de Leon, Almeida Camargo, Müller, Silva, Kozlowiski de Azevedo & Abdallah, 2020	MT512642	Astyanax lacustris	Brazil: Batalha River	Dias et al., 2020
Margotrema bravoae	Lamothe-Argumedo, 1970	KT833278	Allotoca dugesii	Mexico (Central region)	Perez-Ponce de Leon et al., 2016
Margotrema resolanae	Perez-Ponce de Leon, Martinez-Aquino & Mendoza-Garfias, 2013	KT833271	Xenotaenia resolanae	Mexico (Central region)	Perez-Ponce de Leon et al., 2016
Megalogonia ictaluri	Surber, 1928	EF032694	Ictalurus punctatus	USA: Pearl River, Mississippi	Curran et al., 2006
Mesoamericatrema magnisacculus	This study	OP279638- OP279642	Atherinella alvarezi	Mexico: Arroyo San Jose, Chiapas	This study
Paracreptotrema blancoi	Choudhury, Perez Ponce de Leon, Brooks & Daverdin, 2006	KT833285	Priapichthys annectens	Costa Rica: Orosi River	Perez-Ponce de Leon et al., 2016
Paracreptotrema rosenthali	Bautista-Hernandez, Monks, Pulido-Flores & Miranda, 2015	KT833287	Xiphophorus malinche	Mexico: Malila River, Hidalgo	Perez-Ponce de Leon et al., 2016
Paracreptotrematoides heterandriae	(Salgado-Maldonado, Caspeta-Mandujano & Vazquez, 2012) Perez Ponce de Leon, Pinacho-Pinacho, Mendoza-Garfias, Choudhury & Garcia-Varela, 2016	KF697693	Heterandria bimaculata	Mexico: Agua Bendita, Xico, Veracruz	Razo-Mendivil et al., 2014a
Pseudoparacreptotrema axtlaensis	Mendoza-Garfias & Choudhury, 2020	MT180832	Agonostomus monticola	Mexico: Axtla de Terrazas, San Luis Potosi	Perez-Ponce de Leon et al., 2020
Pseudoparacreptotrema falciformis	Hernändez-Mena & Pinacho-Pinacho, 2020	MT180829	Agonostomus monticola	Mexico: Matias Romero, Oaxaca	Perez-Ponce de Leon et al., 2020
Pseudoparacreptotrema macroacetabulata	Perez Ponce de Leon, Pinacho-Pinacho, Mendoza-Garfias, Choudhury & Garcia-Varela, 2016	KT833322	Profundulus kreiseri	Guatemala: Puente Sansare	Perez-Ponce de Leon et al., 2016
Pseudoparacreptotrema pacificum	Sereno-Uribe & Garcia-Varela, 2020	MT180810	Agonostomus monticola	Costa Rica: Rio Lajas	Perez-Ponce de Leon et al., 2020
Pseudoparacreptotrema profundulusi	(Salgado-Maldonado, Caspeta-Mandujano & Martinez- Ramirez, 2011) Perez Ponce de Leon, Pinacho-Pinacho, Mendoza-Garfias, Choudhury & Garcia-Varela, 2016	KT833290	Profundulus sp.	Mexico: Templo River, San Juan del Rio, Oaxaca	Perez-Ponce de Leon et al., 2016
Wallinia anindoi	Hernändez Mena, Pinacho-Pinacho, Garcia-Varela, Mendoza- Garfias & Perez-Ponce de Leon, 2018	MH997003	Astyanax aeneus	Mexico: San Juan del Rio, Oaxaca	Hernändez Mena et al., 2018
Wallinia brasiliensis	Dias, Müller, Almeida, Silva, Azevedo, Perez-Ponce de Leon & Abdallah, 2018	MH520995	Astyanax fasciatus	Brazil: Upper Paranä River Basin	Dias et al., 2018
Wallinia caririensis	Silva, Dias, Silva & Yamada, 2020	MW024866	Astyanax bimaculatus	Brazil: Batateiras River	da Silva et al., 2021
Wallinia chavarriae	Choudhury, Daverdin & Brooks, 2002	HC833703	Astyanax aeneus	Costa Rica: Animas River, Guanacaste	Curran et al., 2011
Wallinia mexicana	Perez-Ponce de Leon, Razo-Mendivil, Mendoza-Garfia, Rubio-Godoy & Choudhury, 2015	KJ535504	Astyanax mexicanus	Mexico: Covadonga River, Durango	Perez-Ponce de Leon et al., 2016
CALLODISTOMIDAE	Odhner, 1910
Prosthenhystera caballeroi	Jimenez-Guzmän, 1973	KM871185	Astyanax aeneus	Costa Rica: Tampisquto River, Guanacaste	Tkach and Curran, 2015
Prosthenhystera obesa	(Diesing, 1850) Travassos, 1922	AY222206	Hoplias sp.	Peru: Itaya River, Iquitos	Olson et al., 2003
Prosthenhystera oonastica	Tkach & Curran, 2015	KM871181	Pylodictis olivaris	USA: Pearl River, Mississippi	Tkach and Curran, 2015

Genetic distances between Mesoamericatrema magnisacculus n. gen. n. sp. and the Allocreadiidae species of the Neotropical clade in the 28S and ITS ribosomal genes (na= sequences not available in Genbank).

Species	Mesoamericatrema magnisacculus
Species	28S	ITS
Creptotrema schubarti	5.63	na
Creptotrema guacurarii	5.37	na
Creptotrema creptotrema	5.53	na
Creptotrema tica	3.75	na
Creptotrema cf. stenopteri	5.01	na
Creptotrema megacetabularis	4.71	na
Creptotrema totonacapanensis	3.83	4.94
Creptotrema conconae	6.42	na
Creptotrema lobata	3.75	4.63
Creptotrema astyanace	3.79	4.40
Wallinia brasiliensis	5.20	na
Wallinia anindoi	5.43	na
Wallinia caririensis	6.24	na
Wallinia mexicana	5.76	na
Wallinia chavarriae	3.94	5.12
Creptotrematina batalhensis	5.46	4.81
Creptotrematina aguirrepequenoi	4.59	5.65
Paracreptotrema blancoi	3.91	7.29
Paracreptotrema rosenthali	5.69	8.27
Paracreptotrematoides heterandriae	4.62	4.34
Pseudoparacreptotrema axtlaense	5.03	na
Pseudoparacreptotrema falciforme	4.86	na
Pseudoparacreptotrema macroacetabulatum	3.93	7.56
Pseudoparacreptotrema pacificum	5.61	na
Pseudoparacreptotrema profundulusi	5.29	7.56

Referenzen

Atopkin, D.M., Shedko, M.B. (2014): Genetic characterization of far eastern species of the genus Crepidostomum (Trematoda: Allocreadiidae) by means of 28S ribosomal DNA sequences. Adv Biosci Biotechnol, 5: 209–215. DOI: 10.4236/abb.2014.53027 Atopkin D.M. Shedko M.B. 2014 Genetic characterization of far eastern species of the genus Crepidostomum (Trematoda: Allocreadiidae) by means of 28S ribosomal DNA sequences Adv Biosci Biotechnol 5 209 215 10.4236/abb.2014.53027DOI öffnen Search in Google Scholar

Atopkin, D.M., Sokolov, S.G., Shedko, M.B., Vainutis, K.S., Orlovskaya, O.M. (2018): Diversity of the genus Bunodera Railliet, 1896 (Trematoda: Allocreadiidae) in the northern part of Eastern Europe and North-eastern Asia, estimated from 28S rDNA sequences, with a description of Bunodera vytautasi sp. nov. Parasitol Res, 117: 1765 –1772. DOI: 10.1007/s00436-018-5858-y Atopkin D.M. Sokolov S.G. Shedko M.B. Vainutis K.S. Orlovskaya O.M. 2018 Diversity of the genus Bunodera Railliet, 1896 (Trematoda: Allocreadiidae) in the northern part of Eastern Europe and North-eastern Asia, estimated from 28S rDNA sequences, with a description of Bunodera vytautasi sp nov. Parasitol Res 117 1765 1772 10.1007/s00436-018-5858-y29633018DOI öffnen Search in Google Scholar

Atopkin, D.M., Sokolov, S.G., Vainutis, K.S., Voropaeva, E.L., Shedko, M.B., Choudhury, A. (2020): Amended diagnosis, validity and relationships of the genus Acrolichanus Ward, 1917 (Digenea: Allocreadiidae) based on the 28S rRNA gene, and observations on its lineage diversity. Syst Parasitol, 97:143–156. DOI: 10.1007/s11230-020-09901-z Atopkin D.M. Sokolov S.G. Vainutis K.S. Voropaeva E.L. Shedko M.B. Choudhury A. 2020 Amended diagnosis, validity and relationships of the genus Acrolichanus Ward, 1917 (Digenea: Allocreadiidae) based on the 28S rRNA gene, and observations on its lineage diversity Syst Parasitol 97143 156 10.1007/s11230-020-09901-z32065373DOI öffnen Search in Google Scholar

Aguilar-Aguilar, R., Contreras-Medina, R., SalgadoMaldonado, G. (2003): Parsimony analysis of endemicity (PAE) of mexican hydrological basins based on helminth parasites of freshwater fishes. J Biogeogr, 30: 1861–1872. DOI: 10.1111/j.1365-2699.2003.00931.x Aguilar-Aguilar R. Contreras-Medina R. SalgadoMaldonado G. 2003 Parsimony analysis of endemicity (PAE) of mexican hydrological basins based on helminth parasites of freshwater fishes J Biogeogr 30 1861 1872 10.1111/j.1365-2699.2003.00931.xDOI öffnen Search in Google Scholar

Albert, J. S., Reis, R. E. (2011): Historical Biogeography of Neotropical Freshwater Fishes. 1^st Edition, Berkeley, USA, University of California Press, 390 pp. DOI: 10.1525/california/9780520268685.001.0001 Albert J. S. Reis R. E. 2011 Historical Biogeography of Neotropical Freshwater Fishes. 1^st Edition Berkeley, USA University of California Press 390 pp 10.1525/california/9780520268685.001.0001DOI öffnen Search in Google Scholar

Bray, R.A., Foster, G.N., Waeschenbach, A., Littlewood, D.T.J. (2012): The discovery of progenetic Allocreadium neotenicum Peters, 1957 (Digenea: Allocreadiidae) in water beetles (Coleoptera: Dytiscidae) in Great Britain. Zootaxa, 3577: 58–70. DOI: 10.11646/zootaxa.3577.1.3 Bray R.A. Foster G.N. Waeschenbach A. Littlewood D.T.J. 2012 The discovery of progenetic Allocreadium neotenicum Peters, 1957 (Digenea: Allocreadiidae) in water beetles (Coleoptera: Dytiscidae) in Great Britain Zootaxa 3577 58 70 10.11646/zootaxa.3577.1.3DOI öffnen Search in Google Scholar

Caira, J. N., Bogéa, T. (2005): Family Allocreadiidae Looss, 1902. In: Jones, A., Bray, R.A., Gibson, D.I. (Eds) Keys to the Trematoda. Volume 2. London, UK: CABI Publishing and The Natural History Museum, pp. 417–436 Caira J. N. Bogéa T. 2005 Family Allocreadiidae Looss, 1902 In Jones A. Bray R.A. Gibson D.I. Eds Keys to the Trematoda. Volume 2 London, UK CABI Publishing and The Natural History Museum pp 417 43610.1079/9780851995878.0417Search in Google Scholar

Chakrabarty, P., Albert, J.S. (2011): Not so fast: A new take on the Great American Biotic Interchange. In: Albert, J.S., Reis, R.E. (Eds) Historical biogeography of Neotropical freshwater fishes. 1^st Edition, Berkeley, USA: University of California Press, pp. 293–305. DOI: 10.1525/california/9780520268685.001.0001 Chakrabarty P. Albert J.S. 2011 Not so fast: A new take on the Great American Biotic Interchange. In Albert J.S. Reis R.E. Eds Historical biogeography of Neotropical freshwater fishes. 1^st Edition Berkeley, USA University of California Press pp 293 305 10.1525/california/9780520268685.001.0001DOI öffnen Search in Google Scholar

Choudhury, A., Regagnon, V.L. (2005): Molecular phylogenetics and biogeography of Bunodera spp. (Trematoda: Allocreadiidae), parasites of percid and gasterosteid fishes. Can J Zoo, 83: 1540–1546. DOI: 10.1139/z05-153 Choudhury A. Regagnon V.L. 2005 Molecular phylogenetics and biogeography of Bunodera spp (Trematoda: Allocreadiidae), parasites of percid and gasterosteid fishes. Can J Zoo 83 1540 1546 10.1139/z05-153DOI öffnen Search in Google Scholar

Choudhury, A., García-Varela, M., Pérez-Ponce de León, G. (2017): Parasites of freshwater fishes and the Great American Biotic Interchange: a bridge too far?. J Helminthol, 91: 174–196. DOI: 10.1017/S0022149X16000407 Choudhury A. García-Varela M. Pérez-Ponce de León G. 2017 Parasites of freshwater fishes and the Great American Biotic Interchange: a bridge too far? J Helminthol 91 174 196 10.1017/S0022149X1600040727376756DOI öffnen Search in Google Scholar

Choudhury, A., Pérez-Ponce de León, G., Brooks, D.R., Daver-din, R. (2006): Paracreptotrema blancoi n. gen., n. sp. (Digenea: Plagiorchiformes: Allocreadiidae) in the Olomina, Priapichthys annectens (Osteichthyes: poeciliidae), from the Area de Conservación Guanacaste, Costa Rica. J Parasitol, 92: 565–568. DOI: 10.1645/GE-3540.1 Choudhury A. Pérez-Ponce de León G. Brooks D.R. Daver-din R. 2006 Paracreptotrema blancoi n gen., n. sp. (Digenea: Plagiorchiformes: Allocreadiidae) in the Olomina, Priapichthys annectens (Osteichthyes: poeciliidae), from the Area de Conservación Guanacaste, Costa Rica. J Parasitol 92 565 568 10.1645/GE-3540.116884000DOI öffnen Search in Google Scholar

Choudhury, A., Aguirre-Macedo, M.L., Curran, S.S., de Núñez, M.O., Overstreet, R.M., Pérez- Ponce de León, G., Santos, C.P. (2016): Trematode diversity in freshwater fishes of the Globe II: ‘New World’. Syst Parasitol, 93: 271–282. DOI: 10.1007/s11230-016-9632-1 Choudhury A. Aguirre-Macedo M.L. Curran S.S. de Núñez M.O. Overstreet R.M. Pérez- Ponce de León G. Santos C.P. 2016 Trematode diversity in freshwater fishes of the Globe II: ‘New World’ Syst Parasitol 93 271 282 10.1007/s11230-016-9632-126898590DOI öffnen Search in Google Scholar

Curran, S.S., Tkach, V.V., Overstreet, R.M. (2006): A review of Polylekithum Arnold, 1934 and its familial affinities using morphological and molecular data, with description of Polylekithum catahoulensis sp. nov.. Acta Parasitol, 51: 238–248. DOI: 10.2478/s11686-006-0037-1 Curran S.S. Tkach V.V. Overstreet R.M. 2006 A review of Polylekithum Arnold, 1934 and its familial affinities using morphological and molecular data, with description of Polylekithum catahoulensis sp nov.. Acta Parasitol 51 238 248 10.2478/s11686-006-0037-1DOI öffnen Search in Google Scholar

Curran, S.S., Tkach, V.V., Overstreet, R.M. (2011): Phylogenetic affinities of Auriculostoma (Digenea: Allocreadiidae), with descriptions of two new species from Peru. J Parasitol, 97: 661–670. DOI: 10.1645/GE-2641.1 Curran S.S. Tkach V.V. Overstreet R.M. 2011 Phylogenetic affinities of Auriculostoma (Digenea: Allocreadiidae), with descriptions of two new species from Peru J Parasitol 97 661 670 10.1645/GE-2641.121506841DOI öffnen Search in Google Scholar

Curran, S.S., Pulis, E.E., Hug, D.O., Brown, J.P., Manuel, L.C., Overstreet, R.M. (2012): Phylogenetic position of Creptotrema funduli in the Allocreadiidae based on partial 28S rDNA sequences. J Parasitol, 98: 873–875. DOI: 10.1645/GE-3066.1 Curran S.S. Pulis E.E. Hug D.O. Brown J.P. Manuel L.C. Overstreet R.M. 2012 Phylogenetic position of Creptotrema funduli in the Allocreadiidae based on partial 28S rDNA sequences J Parasitol 98 873 875 10.1645/GE-3066.122288517DOI öffnen Search in Google Scholar

da Silva, B.A.F., Dias, K.G.A., da Silva, R.J., Yamada, F.H. (2021): A new species of Wallinia Pearse, 1920 (Digenea: Allocreadiidae), in Astyanax bimaculatus (Linnaeus, 1758) (Characidae) in Northeast Brazil, based on morphology and DNA sequences. Parasitol Res, 120: 37–44. DOI: 10.1007/s00436-020-06948-1 da Silva B.A.F. Dias K.G.A. da Silva R.J. Yamada F.H. 2021 A new species of Wallinia Pearse, 1920 (Digenea: Allocreadiidae), in Astyanax bimaculatus (Linnaeus, 1758) (Characidae) in Northeast Brazil, based on morphology and DNA sequences Parasitol Res 120 37 44 10.1007/s00436-020-06948-133241440DOI öffnen Search in Google Scholar

Darriba, D., Taboada, G.L., Doallo, R., Posada, D. (2012): jModel-Test 2: more models, new heuristics and parallel computing. Nat Methods, 9: 772. DOI: 10.1038/nmeth.2109 Darriba D. Taboada G.L. Doallo R. Posada D. 2012 jModel-Test 2: more models, new heuristics and parallel computing Nat Methods 9 772 10.1038/nmeth.2109459475622847109DOI öffnen Search in Google Scholar

Dias, K.G., Pérez-Ponce de León, G., de Almeida-Camargo, A., Müller, M.I., da Silva, R.J., Kozlowiski-de Azevedo, R., Abdallah, V.D. (2020): A new species of Creptotrematina (Trematoda: Allocreadiidae) from characid fishes of Brazil: morphological and molecular data. J Helminthol, 94: e163. DOI: 10.1017/S0022149X20000474 Dias K.G. Pérez-Ponce de León G. de Almeida-Camargo A. Müller M.I. da Silva R.J. Kozlowiski-de Azevedo R. Abdallah V.D. 2020 A new species of Creptotrematina (Trematoda: Allocreadiidae) from characid fishes of Brazil: morphological and molecular data J Helminthol 94 e163 10.1017/S0022149X2000047432539878DOI öffnen Search in Google Scholar

Franceschini, L., Aguiar, A., Zago, A.C., de Oliveira, F., Yamada, P., Bertholdi, E.M., da Silva, R.J. (2021): Three new species of Creptotrema (Trematoda, Allocreadiidae) with an amended diagnosis of the genus and reassignment of Auriculostoma (Allocreadiidae), based on morphological and molecular evidence. Parasite, 28: 69. DOI: 10.1051/parasite/2021065 Franceschini L. Aguiar A. Zago A.C. de Oliveira F. Yamada P. Bertholdi E.M. da Silva R.J. 2021 Three new species of Creptotrema (Trematoda, Allocreadiidae) with an amended diagnosis of the genus and reassignment of Auriculostoma (Allocreadiidae), based on morphological and molecular evidence Parasite 28 69 10.1051/parasite/2021065851351934643505DOI öffnen Search in Google Scholar

Galaviz-Silva, L., Molina-Garza, Z.J., Escobar-Gonzalez, B., Iruegas-Buentello, F. J. (2013): Metazoan parasites of the channel catfish (Ictalurus punctatus) from three dams in Nuevo Leon, Mexico. Hidrobiológica, 23: 394–398 Galaviz-Silva L. Molina-Garza Z.J. Escobar-Gonzalez B. Iruegas-Buentello F. J. 2013 Metazoan parasites of the channel catfish (Ictalurus punctatus) from three dams in Nuevo Leon, Mexico Hidrobiológica 23 394 398Search in Google Scholar

García-Varela, M., Nadler, S.A. (2005): Phylogenetic relationships of Palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences. J Parasitol, 91: 1401–1409. DOI: 10.1645/GE-523R.1 García-Varela M. Nadler S.A. 2005 Phylogenetic relationships of Palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences J Parasitol 91 1401 1409 10.1645/GE-523R.116539024DOI öffnen Search in Google Scholar

Hernández-Mena, D.I., García-Prieto, L., García-Varela, M. (2014): Morphological and molecular differentiation of Parastrigea (Trematoda: Strigeidae) from Mexico, with the description of a new species. Parasitol Int, 63: 315–323. DOI: 10.1016/j. parint.2013.11.012 Hernández-Mena D.I. García-Prieto L. García-Varela M. 2014 Morphological and molecular differentiation of Parastrigea (Trematoda: Strigeidae) from Mexico, with the description of a new species Parasitol Int 63 315 323 10.1016/j.parint.2013.11.01224309555DOI öffnen Search in Google Scholar

Hernández-Mena, D.I., Lyngard, C., Mendoza-Garfias, B., Pérez-Ponce de León, G.P. (2016): A new species of Auriculostoma (Trematoda: Allocreadiidae) from the intestine of Brycon guatemalensis (Characiformes: Bryconidae) from the Usumacinta River Basin, Mexico, based on morphology and 28S rDNA sequences, with a key to species of the genus. Zootaxa, 4196. DOI: 10.11646/zootaxa.4196.2.5 Hernández-Mena D.I. Lyngard C. Mendoza-Garfias B. Pérez-Ponce de León G.P. 2016 A new species of Auriculostoma (Trematoda: Allocreadiidae) from the intestine of Brycon guatemalensis (Characiformes: Bryconidae) from the Usumacinta River Basin, Mexico, based on morphology and 28S rDNA sequences, with a key to species of the genus Zootaxa 4196 10.11646/zootaxa.4196.2.527988675DOI öffnen Search in Google Scholar

Hernández-Mena, D.I., Pinacho-Pinacho, C.D., García-Varela, M., Mendoza-Garfias, B., Pérez-Ponce de León, G. (2019): Description of two new species of allocreadiid trematodes (Digenea: Allocreadiidae) in middle American freshwater fishes using an integrative taxonomy approach. Parasitol Res, 118: 421–432. DOI: 10.1007/s00436-018-6160-8 Hernández-Mena D.I. Pinacho-Pinacho C.D. García-Varela M. Mendoza-Garfias B. Pérez-Ponce de León G. 2019 Description of two new species of allocreadiid trematodes (Digenea: Allocreadiidae) in middle American freshwater fishes using an integrative taxonomy approach Parasitol Res 118 421 432 10.1007/s00436-018-6160-830506515DOI öffnen Search in Google Scholar

Liu, K., Raghavan, S., Nelesen, S., Linder, C.R., Warnow, T. (2009): Rapid and accurate large-scale coestimation of sequence alignments and phylogenetic trees. Science, 324: 1561–1564. DOI: 10.1126/science.1171243 Liu K. Raghavan S. Nelesen S. Linder C.R. Warnow T. 2009 Rapid and accurate large-scale coestimation of sequence alignments and phylogenetic trees Science 324 1561 1564 10.1126/science.117124319541996DOI öffnen Search in Google Scholar

Liu, K., Warnow, T.J., Holder, M.T., Nelesen, S.M., Yu, J., Stamatakis, A.P., Linder, C.R. (2012): SATe-II: very fast and accurate simultaneous estimation of multiple sequence alignments and phylogenetic trees. Syst Biol, 61: 90–106. DOI: 10.1093/sysbio/syr095 Liu K. Warnow T.J. Holder M.T. Nelesen S.M. Yu J. Stamatakis A.P. Linder C.R. 2012 SATe-II: very fast and accurate simultaneous estimation of multiple sequence alignments and phylogenetic trees Syst Biol 61 90 106 10.1093/sysbio/syr09522139466DOI öffnen Search in Google Scholar

Luton, K., Walker, D., Blair, D. (1992): Comparison of ribosomal internal transcribed spacer from two congeneric species of flukes (Plathyhelminthes: Trematoda: Digenea). Mol Biochem Parasitol, 56: 323–328. DOI: 10.1016/0166-6851(92)90181-i Luton K. Walker D. Blair D. 1992 Comparison of ribosomal internal transcribed spacer from two congeneric species of flukes (Plathyhelminthes: Trematoda: Digenea) Mol Biochem Parasitol 56 323 328 10.1016/0166-6851(92)90181-i1484553DOI öffnen Search in Google Scholar

Miller, R.R., Minckley, W.L., Norris, S.M. (2005): Freshwater fishes of Mexico. Chicago, USA, The University of Chicago Press, 559 pp. Miller R.R. Minckley W.L. Norris S.M. 2005 Freshwater fishes of Mexico Chicago, USA The University of Chicago Press 559 ppSearch in Google Scholar

Montes, M.M., Barneche, J., Croci, Y., Balcazar, D., Almirón, A., Martorelli, S., Pérez-Ponce de León, G. (2021): Description of a new species of Auriculostoma (Digenea: Allocreadiidae) from Characidium heirmostigmata (Characiformes: Crenuchidae) from Argentina, using morphological and molecular data. J Helminthol, 95: e19. DOI: 10.1017/S0022149X21000109 Montes M.M. Barneche J. Croci Y. Balcazar D. Almirón A. Martorelli S. Pérez-Ponce de León G. 2021 Description of a new species of Auriculostoma (Digenea: Allocreadiidae) from Characidium heirmostigmata (Characiformes: Crenuchidae) from Argentina, using morphological and molecular data J Helminthol 95 e19 10.1017/S0022149X2100010933818327DOI öffnen Search in Google Scholar

Moravec, F., Salgado-Maldonado, G., Caspeta-Mandujano, J.M. (2010): Spinitectus osorioi (Nematoda: Cystidicolidae) in the Mexican endemic fish Atherinella alvarezi (Atherinopsidae) from the Atlantic River drainage system in Chiapas, Southern Mexico. Mem Inst Oswaldo Cruz, 105: 52–56. DOI: 10.1590/s0074-02762010000100007 Moravec F. Salgado-Maldonado G. Caspeta-Mandujano J.M. 2010 Spinitectus osorioi (Nematoda: Cystidicolidae) in the Mexican endemic fish Atherinella alvarezi (Atherinopsidae) from the Atlantic River drainage system in Chiapas, Southern Mexico Mem Inst Oswaldo Cruz 105 52 56 10.1590/s0074-0276201000010000720209329DOI öffnen Search in Google Scholar

Morrone, J.J. (2014): Biogeographical regionalization of the Neotropical region. Zootaxa, 3782: 1–110. DOI: 10.11646/zo-otaxa.3782.1.1 Morrone J.J. 2014 Biogeographical regionalization of the Neotropical region Zootaxa 3782 1 110 10.11646/zo-otaxa.3782.1.1DOI öffnen Search in Google Scholar

Morrone, J.J. (2020): The Mexican Transition Zone: A Natural Biogeographic Laboratory to Study Biotic Assembly. 1^st Edition, Cham, Switzerland, Springer, 191 pp. DOI: 10.1007/978-3-03047917-6 Morrone J.J. 2020 The Mexican Transition Zone: A Natural Biogeographic Laboratory to Study Biotic Assembly. 1^st Edition Cham, Switzerland Springer 191 pp 10.1007/978-3-03047917-6DOI öffnen Search in Google Scholar

Nadler, S.A., Hudspeth, D.S.S. (1998): Ribosomal DNA and phylogeny of the Ascaridoidea (Nemata: Secernentea): implications for morphological evolution and classification. Mol Phylogenet Evol, 10: 221–236. DOI: 10.1006/mpev.1998.0514 Nadler S.A. Hudspeth D.S.S. 1998 Ribosomal DNA and phylogeny of the Ascaridoidea (Nemata: Secernentea): implications for morphological evolution and classification Mol Phylogenet Evol 10 221 236 10.1006/mpev.1998.05149878233DOI öffnen Search in Google Scholar

Olson, P.D., Crib, T.H., Tkach, V.V., Bray, R.A., Littlewood, D.T. (2003): Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). Int J Parasitol, 33: 733–755. DOI: 10.1016/s0020-7519(03)00049-3 Olson P.D. Crib T.H. Tkach V.V. Bray R.A. Littlewood D.T. 2003 Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda) Int J Parasitol 33 733 755 10.1016/s0020-7519(03)00049-312814653DOI öffnen Search in Google Scholar

Pérez-Ponce de León, G., Choudhury, A. (2005): Biogeography of helminth parasites of freshwater fishes in Mexico: the search for patterns and processes. J Biogeogr, 32: 645–659. DOI: 10.1111/j.1365-2699.2005.01218.x Pérez-Ponce de León G. Choudhury A. 2005 Biogeography of helminth parasites of freshwater fishes in Mexico: the search for patterns and processes J Biogeogr 32 645 659 10.1111/j.1365-2699.2005.01218.xDOI öffnen Search in Google Scholar

Pérez-Ponce de León, G., García-Prieto, L., Mendoza-Garfias, B. (2007): Trematode parasites (Platyhelminthes) of wildlife vertebrates in Mexico. Zootaxa, 1534. DOI: 10.11646/zootaxa.1534.1.1 Pérez-Ponce de León, G., Martínez-Aquino, A., Mendoza-Garfias, B. (2013): A new species of Margotrema (Digenea, Allocreadiidae) from the leopard splitfin Xenotaenia resolanae (Cyprinodontiformes, Goodeidae) from west-central Mexico. Zootaxa, 3670: 94–96. DOI: 10.11646/zootaxa.3670.1.10 Pérez-Ponce de León G. García-Prieto L. Mendoza-Garfias B. 2007 Trematode parasites (Platyhelminthes) of wildlife vertebrates in Mexico Zootaxa 1534 10.11646/zootaxa.1534.1.1 Pérez-Ponce de León, G., Martínez-Aquino, A., Mendoza-Garfias, B. (2013): A new species of Margotrema (Digenea, Allocreadiidae) from the leopard splitfin Xenotaenia resolanae (Cyprinodontiformes, Goodeidae) from west-central Mexico. Zootaxa 3670 94-96 10.11646/zootaxa.3670.1.10DOI öffnen Search in Google Scholar

Pérez-Ponce de León, G.P., Razo-Mendivil, U., Mendoza-Garfias, B., Rubio-Godoy, M., Choudhury, A. (2015): A new species of Wallinia Pearse, 1920 (Digenea: Allocreadiidae) in Astyanax mexicanus (Characidae) from Mexico revealed by morphology and sequences of the 28S ribosomal RNA gene. Folia Parasitol, 62: 2015.018. DOI: 10.14411/fp.2015.018 Pérez-Ponce de León G.P. Razo-Mendivil U. Mendoza-Garfias B. Rubio-Godoy M. Choudhury A. 2015 A new species of Wallinia Pearse, 1920 (Digenea: Allocreadiidae) in Astyanax mexicanus (Characidae) from Mexico revealed by morphology and sequences of the 28S ribosomal RNA gene Folia Parasitol 62 2015 018 10.14411/fp.2015.01825960562DOI öffnen Search in Google Scholar

Pérez-Ponce de León, G., Pinacho-Pinacho, C.D., Mendoza-Garfias, B., Choudhury, A., García-Varela, M. (2016): Phylogenetic Analysis Using the 28S rRNA Gene Reveals That the Genus Paracreptotrema (Digenea: Allocreadiidae) Is Not Monophyletic; Description of Two New Genera and One New Species. J Parasitol, 102: 131–142. DOI: 10.1645/15-815 Pérez-Ponce de León G. Pinacho-Pinacho C.D. Mendoza-Garfias B. Choudhury A. García-Varela M. 2016 Phylogenetic Analysis Using the 28S rRNA Gene Reveals That the Genus Paracreptotrema (Digenea: Allocreadiidae) Is Not Monophyletic; Description of Two New Genera and One New Species J Parasitol 102 131 142 10.1645/15-81526561039DOI öffnen Search in Google Scholar

Pérez-Ponce de León, G., Sereno-Uribe, A.L., García-Varela, M., Mendoza-Garfias, B., Hernández-Mena, D.I., Pinacho-Pinacho, C.D., Choudhury, A. (2020): Disentangling the evolutionary and biogeographical history of the freshwater fish trematode genus Creptotrema (Digenea: Allocreadiidae) using an integrative taxonomy approach: the case of Creptotrema agonostomi in Middle American mountain mullets. J. Helminthol, 94: 171. DOI: 10.1017/S0022149X2000053X Pérez-Ponce de León G. Sereno-Uribe A.L. García-Varela M. Mendoza-Garfias B. Hernández-Mena D.I. Pinacho-Pinacho C.D. Choudhury A. 2020 Disentangling the evolutionary and biogeographical history of the freshwater fish trematode genus Creptotrema (Digenea: Allocreadiidae) using an integrative taxonomy approach: the case of Creptotrema agonostomi in Middle American mountain mullets J. Helminthol 94 171 10.1017/S0022149X2000053X32665055DOI öffnen Search in Google Scholar

Petkeviciūte, R., Stunzenas, V., Staneviciūte, G., Sokolov, S.G. (2010): Comparison of the developmental stages of some European allocreadiid trematode species and a clarification of their life-cycles based on ITS2 and 28S sequences. Syst Parasitol, 76: 169–178. DOI: 10.1007/s11230-010-9249-8 Petkeviciūte R. Stunzenas V. Staneviciūte G. Sokolov S.G. 2010 Comparison of the developmental stages of some European allocreadiid trematode species and a clarification of their life-cycles based on ITS2 and 28S sequences Syst Parasitol 76 169 178 10.1007/s11230-010-9249-820532848DOI öffnen Search in Google Scholar

Petkevičiūtė, R., Stunžėnas, V., Zhokhov, A.E., Poddubnaya, L.G., Stanevičiūtė, G. (2018): Diversity and phylogenetic relationships of European species of Crepidostomum Braun, 1900 (Trematoda: Allocreadiidae) based on rDNA, with special reference to Crepidostomum oschmarini Zhokhov & Pugacheva, 1998. Parasit Vectors, 11: 530. DOI: 10.1186/s13071-018-3095-y Petkevičiūtė R. Stunžėnas V. Zhokhov A.E. Poddubnaya L.G. Stanevičiūtė G. 2018 Diversity and phylogenetic relationships of European species of Crepidostomum Braun, 1900 (Trematoda: Allocreadiidae) based on rDNA, with special reference to Crepidostomum oschmarini Zhokhov & Pugacheva, 1998 Parasit Vectors 11 530 10.1186/s13071-018-3095-y616295630266086DOI öffnen Search in Google Scholar

Razo-Mendivil, U., Pérez-Ponce de León, G.P., Rubio-Godoy, M. (2014a): Testing the systematic position and relationships of Paracreptotrema heterandriae within the Allocreadiidae through partial 28s rRNA gene sequences. J Parasitol, 100: 537–541. DOI: 10.1645/13-421.1 Razo-Mendivil U. Pérez-Ponce de León G.P. Rubio-Godoy M. 2014a Testing the systematic position and relationships of Paracreptotrema heterandriae within the Allocreadiidae through partial 28s rRNA gene sequences J Parasitol 100 537 541 10.1645/13-421.124506321DOI öffnen Search in Google Scholar

Razo-Mendivil, U., Mendoza-Garfias, B., Pérez-Ponce de León, G., Rubio-Godoy M. (2014b): A new species of Auriculostoma (Digenea: Allocreadiidae) in the Mexican tetra Astyanax mexicanus (Actinopterygii: Characidae) from Central Veracruz, Mexico, described with the use of morphological and molecular data. J Parasitol, 100: 331–337. DOI: 10.1645/13-352.1 Razo-Mendivil U. Mendoza-Garfias B. Pérez-Ponce de León G. Rubio-Godoy M. 2014b A new species of Auriculostoma (Digenea: Allocreadiidae) in the Mexican tetra Astyanax mexicanus (Actinopterygii: Characidae) from Central Veracruz, Mexico, described with the use of morphological and molecular data J Parasitol 100 331 337 10.1645/13-352.124428724DOI öffnen Search in Google Scholar

Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A., Huelsenbeck, J.P. (2012): MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol, 61: 539–542. DOI: 0.1093/sysbio/sys029 Ronquist F. Teslenko M. van der Mark P. Ayres D.L. Darling A. Höhna S. Larget B. Liu L. Suchard M.A. Huelsenbeck J.P. 2012 MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space Syst Biol 61 539 542 DOI: 0.1093/sysbio/sys02910.1093/sysbio/sys029332976522357727Search in Google Scholar

Salgado-Maldonado, G., Caspeta-Mandujano, J.M., Moravec, F., Soto-Galera, E., Rodiles-Hernández, R., Cabañas-Carranza, G., Montoya-Mendoza, J. (2011): Helminth parasites of freshwater fish in Chiapas, Mexico. Parasitol Res, 108: 31–59. DOI: 10.1007/s00436-010-2035-3 Salgado-Maldonado G. Caspeta-Mandujano J.M. Moravec F. Soto-Galera E. Rodiles-Hernández R. Cabañas-Carranza G. Montoya-Mendoza J. 2011 Helminth parasites of freshwater fish in Chiapas, Mexico Parasitol Res 108 31 59 10.1007/s00436-010-2035-320981446DOI öffnen Search in Google Scholar

Salgado-Maldonado, G., Caspeta-Mandujano, J.M., Ramírez-Martínez, C., Lozano-Vilano, L., García-Ramírez, M.E., Mendoza-Franco, E.F. (2014): Helmintos parásitos de los peces del río Lacantún en la reserva de la Biosfera Montes Azules, Chiapas. Monterrey, Mexico, Universidad Autónoma de Nuevo León-Natura/y Ecosistemas Mexicanos A. C., 147 pp. Salgado-Maldonado G. Caspeta-Mandujano J.M. Ramírez-Martínez C. Lozano-Vilano L. García-Ramírez M.E. Mendoza-Franco E.F. 2014 Helmintos parásitos de los peces del río Lacantún en la reserva de la Biosfera Montes Azules, Chiapas Monterrey, Mexico Universidad Autónoma de Nuevo León-Natura/y Ecosistemas Mexicanos A. C. 147 ppSearch in Google Scholar

Scholz, T., Aguirre-Macedo, M.L., Choudhury, A. (2004): Auriculostoma astyanace n. gen., n. sp. (Digenea: Allocreadiidae), from the banded astyanax, Astyanax fasciatus (Characiformes: Characidae), from Nicaragua, with a reevaluation of neotropical Crepidostomum spp. J Parasitol, 90: 1128–1132. DOI: 10.1645/GE-3275 Scholz T. Aguirre-Macedo M.L. Choudhury A. 2004 Auriculostoma astyanace n gen., n. sp. (Digenea: Allocreadiidae), from the banded astyanax, Astyanax fasciatus (Characiformes: Characidae), from Nicaragua, with a reevaluation of neotropical Crepidostomum spp. J Parasitol 90 1128 1132 10.1645/GE-327515562614DOI öffnen Search in Google Scholar

Shimazu, T. (2017): Digeneans parasitic in freshwater fishes (Osteichthyes) of Japan XII. A list of the papers of the series, a key to the families in Japan, a parasite-host list, a host-parasite list, Addenda, and Errata. Bull Natl Mus Nat Sci Ser A, 43: 129–143 Shimazu T. 2017 Digeneans parasitic in freshwater fishes (Osteichthyes) of Japan XII A list of the papers of the series, a key to the families in Japan, a parasite-host list, a host-parasite list, Addenda, and Errata. Bull Natl Mus Nat Sci Ser A 43 129 143Search in Google Scholar

Silvestro, D., Michalak, I. (2012): raxmlGUI: a graphical front-end for RaxML. Org Divers Evol, 12: 335–337. DOI: 10.1007/s13127-011-0056-0 Silvestro D. Michalak I. 2012 raxmlGUI: a graphical front-end for RaxML Org Divers Evol 12 335 337 10.1007/s13127-011-0056-0DOI öffnen Search in Google Scholar

Stock, S.P., Campbell, J.F., Nadler, S.A. (2001): Phylogeny of Steinernema travassos, 1927 (Cephalobina: Steinernematidae) inferred from ribosomal DNA sequences and morphological characters. J Parasitol, 87: 877–889. DOI: 10.1645/0022-3395(2001)087[0877:POSTCS]2.0.CO;2 Stock S.P. Campbell J.F. Nadler S.A. 2001 Phylogeny of Steinernema travassos, 1927 (Cephalobina: Steinernematidae) inferred from ribosomal DNA sequences and morphological characters J Parasitol 87 877 889 10.1645/0022-3395(2001)087[0877:POSTCS]2.0.CO;2DOI öffnen Search in Google Scholar

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S. (2013): MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol, 30: 2725–2729. DOI: 10.1093/molbev/mst197 Tkach, V.V., Curran, S.S. (2015): Prosthenystera oonastica n. sp. (Digenea: Callodistomidae) from ictalurid catfishes in southeastern United States and molecular evidence differentiating species in the genus across Americas. Syst Parasitol, 90: 39–51. DOI: 10.1007/s11230-014-9531-2 Tamura K. Stecher G. Peterson D. Filipski A. Kumar S. 2013 MEGA6: Molecular Evolutionary Genetics Analysis version 6.0 Mol Biol Evol 30 2725 2729 10.1093/molbev/mst197 Tkach, V.V., Curran, S.S. (2015): Prosthenystera oonastica n. sp. (Digenea: Callodistomidae) from ictalurid catfishes in southeastern United States and molecular evidence differentiating species in the genus across Americas. Syst Parasitol 90 39-51 10.1007/s11230-014-9531-2DOI öffnen Search in Google Scholar

Tkach, V.V., Curran, S.S., Bell, J.A., Overstreet, R.M. (2013): A new species of Crepidostomum (Digenea: Allocreadiidae) from Hiodon tergisus in Mississippi and molecular comparison with three congeners. J Parasitol, 99:1114–1121. DOI: 10.1645/13279.1 Tkach V.V. Curran S.S. Bell J.A. Overstreet R.M. 2013 A new species of Crepidostomum (Digenea: Allocreadiidae) from Hiodon tergisus in Mississippi and molecular comparison with three congeners J Parasitol 991114 1121 10.1645/13279.1DOI öffnen Search in Google Scholar

WoRMS (2022): Allocreadiidae Looss, 1902. Retrieved from https://www.marinespecies.org/aphia.php?p=taxdetails&id=108431 WoRMS 2022 Allocreadiidae Looss, 1902 Retrieved from https://www.marinespecies.org/aphia.php?p=taxdetails&id=108431Search in Google Scholar

Helminthologia

Discovery of a new genus and species of Allocreadiidae (Trematoda) in Mexico: Mesoamericatrema magnisacculus n. gen. n. sp

B. Mendoza-Garfias,
B. Mendoza-Garfias,
J. G. García-Teh,
J. G. García-Teh,
J. M. Caspeta-Mandujano,
J. M. Caspeta-Mandujano,
V. M. Vidal-Martínez und
V. M. Vidal-Martínez und
D. I. Hernández-Mena
D. I. Hernández-Mena

Online veröffentlicht: 17 Dec 2022

Volumen & Heft: Volumen 59 (2022) - Heft 3 (September 2022)

Seitenbereich: 284 - 300

Eingereicht: 03 Aug 2022

Akzeptiert: 30 Aug 2022

Details zu Zeitschrift und Ausgabe

Helminthologia

PDF-Vorschau

Artikel

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Zahlen und Tabellen

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Trematode species included in phylogenetic analyses with the 28S rRNA gene. The accession number of the Genbank sequences, the host and the locality where the sequenced specimens were collected are shown.

Genetic distances between Mesoamericatrema magnisacculus n. gen. n. sp. and the Allocreadiidae species of the Neotropical clade in the 28S and ITS ribosomal genes (na= sequences not available in Genbank).

Referenzen

Neueste Artikel

Planen Sie Ihre Fernkonferenz mit Scienceendo

Helminthologia

Discovery of a new genus and species of Allocreadiidae (Trematoda) in Mexico: Mesoamericatrema magnisacculus n. gen. n. sp

B. Mendoza-Garfias,B. Mendoza-Garfias,J. G. García-Teh,J. G. García-Teh,J. M. Caspeta-Mandujano,J. M. Caspeta-Mandujano,V. M. Vidal-Martínez undV. M. Vidal-Martínez undD. I. Hernández-MenaD. I. Hernández-Mena

Online veröffentlicht: 17 Dec 2022

Volumen & Heft: Volumen 59 (2022) - Heft 3 (September 2022)

Seitenbereich: 284 - 300

Eingereicht: 03 Aug 2022

Akzeptiert: 30 Aug 2022

Details zu Zeitschrift und Ausgabe

Helminthologia

PDF-Vorschau

Artikel

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Zahlen und Tabellen

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Trematode species included in phylogenetic analyses with the 28S rRNA gene. The accession number of the Genbank sequences, the host and the locality where the sequenced specimens were collected are shown.

Genetic distances between Mesoamericatrema magnisacculus n. gen. n. sp. and the Allocreadiidae species of the Neotropical clade in the 28S and ITS ribosomal genes (na= sequences not available in Genbank).

Referenzen

Neueste Artikel

Planen Sie Ihre Fernkonferenz mit Scienceendo

B. Mendoza-Garfias,
B. Mendoza-Garfias,
J. G. García-Teh,
J. G. García-Teh,
J. M. Caspeta-Mandujano,
J. M. Caspeta-Mandujano,
V. M. Vidal-Martínez und
V. M. Vidal-Martínez und
D. I. Hernández-Mena
D. I. Hernández-Mena